Dear Masters,

I have a series of records (4 lines per record) in FastQ format from DNA sequencing projects. The data actually come for 3 different replicates that are "barcoded". The barcode is basically the first 9 letters in the second line of the record. In the example below:

@DJB775P1:314:C0K9AACXX:3:1101:1597:2067 1:N:0:

AGTTTGTATAGCACGCGCGCCAGCAGCTGCAGCAGGTGCCCGGGCTGCTGG

+

CCCFFFFFHHHHHJJJJJJJIJJJJJIJIJJJIJJJFGIJJIJHGFFFFEE

@DJB775P1:314:C0K9AACXX:3:1101:1644:2074 1:N:0:

CTTGGTTAGAGCTCTTTCTCGATTCCGTGGGTGGTGGTGCAGATCGGAAGA

+

CCCFFDFFHHHHHJJJJJJJJJJJJJJFHIJCGIDGIGHGIJJJJJJHIBH

@DJB775P1:314:C0K9AACXX:3:1101:1707:2079 1:N:0:

ACGACCTTATAAACGGGTGGGGTCCGCGCAGTCCGCCCGGAGGATTAGATC

+

@CCFFFFFHGGHHJJJJ<CGHJCGIJIIJ@AFCHEHHHBEACD?CCDCCDD

@DJB775P1:314:C0K9AACXX:3:1101:1543:2082 1:N:0:

TCTTTGTTCAACCAAAGTCTTTGGGTTCCGGGGGGAGTATGGTTGAGATCG

+

@@CFFFDFHHHHHJJJJEIJIJIJJJJJJJJJJJD9B<CDDDCDDDDDCDD

There are 4 records and the first 9 letters for each record are the following:

AGTTTGTAT

CTTGGTTAG

ACGACCTTA

TCTTTGTTC

Thus, the general form of the barcode is the following:

NNNXXXXNN , where N can be either of the following letters: A, C, T or G and XXXX is either TTGT, GGTT or ACCT (one for each library). As you can see record 1 and record 4 belong to the same replicate.

I would like to separae the records that I have (currently in a single file) into 3 separate files based on the either TTGT, GGTT or ACCT. Currently, the main file is about ~34GB in size.

I wonder if anyone can make a suggestion about how I can go about doing this using perl and bioperl module. I am a complete newbie in perl programming.

Thank you very much for your time and for reading my post.

Regards,

snakebites

In reply to Deconvolutinng FastQ files by snakebites

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.