Re: substr help

my $dna = 'accatgagctgtacgtagcatctgagcgcgcatgactgtgactgacgtaggcagca';

my $increment = 3;
my @windows;
for ( my $loc=0; $loc <= (length($dna)-10); $loc+=$increment ){
    push @windows, substr($dna, $loc, 10);
}

print "$_\n" for @windows;
[download]

If you have multiple $dna sequences you'll probably want an outer loop to iterate over an array holding them. Otherwise, this code ought to do what you're looking for.

It's one of the few instances where I would actually use a C-style 'for' loop.

You could also do it with a regexp.

Update: Replaced (length($dna)-$increment) with (length($dna)-10) per duff's comment. Good catch!

Dave

Comment on Re: substr help Select or Download Code

Replies are listed 'Best First'.
Re: Re: substr help by duff (Parson) on May 12, 2004 at 16:11 UTC
Surely that should be `for ( my $loc = 0; $loc <= length($dna) - 10; $loc += $increment ) {` [download] Otherwise his last few strings won't be 10 characters long. Even though I have done this exact thing (sliding window with overlaps) in the past using a C-style for loop, I think I'd probably write it like this these days: `my $end = int((length($dna) - 10)/3); for my $i (0..$end) { push @windows, substr($dna,$i3,10); }` [download] or more likely `my @windows = map { substr($dna,$_3,10) } 0..int((length($dna)-10)/3) +;` [download] duff	[reply] [d/l] [select]
Re: Re: substr help by ysth (Canon) on May 12, 2004 at 18:05 UTC
You could also do it with a regexp. Which would look something like: `my $dna = 'accatgagctgtacgtagcatctgagcgcgcatgactgtgactgacgtaggcagca'; my $increment = 3; my $substr = 10; my @windows = $dna=~/(?=(.{$substr})).{$increment}/gs; print "$_\n" for @windows;` [download]	[reply] [d/l]