It's not clear exactly where you expect your output to be. You're calling substr inside the loop, but throwing away the results, then putting the original string $dna into the @windows list.

Also, the third argument to substr is the number of characters you want; using 0 will always return an empty string. And in your loop, you're starting at 10 and stopping when the position is greater than the number of elements in @dna, but there's only one element in that list, so the loop never executes.

I think something closer to what you mean is:

use constant MOVEMENT => 3;
use constant WINDOWSIZE => 10;

my $dna = 'accatgagctgtacgtagcatctgagcgcgcatgactgtgactgacgtaggcagca';
my @windows=();
for (my $pos = 0; $pos <= (length($dna) - WINDOWSIZE); $pos += MOVEMEN
+T)  {
     push(@windows,substr($dna,$pos,WINDOWSIZE));
}
                                                                      
print "@windows\n";
[download]