Here's a little different way to do it.

With PerlIO, Perl 5.8+,

my $dna = q(accatgagctgtacgtagcatctgagcgcgcatgactgtgactgacgtaggcagca);
my $skip = 10;
{
    local ($/, $\) = (\10, "\n");
    open my $chain, '<', \substr($dna, $skip) or die $!;
    print while <$chain>;
    close $chain or die $!;
}
[download]

That makes use of the PerlIO trick of opening a scalar as a file by putting a reference to it in open's filespec slot. Setting $/ to a reference to constant three makes any filehandle be read three characters at a time. Setting $\, the output record seperator, to newline inserts one after every print statement executed.

Update: Oops, I also misread. Not a solution to what was asked.