Re^2: non-exact regexp matches

Hi, I tested your program on the following sequence:


ACCAACCGGATTCTAGATGCAGATGTTGAAGATT # works OK.

Change the second C for a G:

AGCAACCGGATTCTAGATGCAGATGTTGAAGATT # Doesn't work.
[download]

I'm looking over your regexp... bu it'll take me a while to figure it out. Thanks for the help. Vince

Comment on Re^2: non-exact regexp matches Download Code

Replies are listed 'Best First'.
Re^3: non-exact regexp matches by japhy (Canon) on Jun 25, 2004 at 15:22 UTC
That's because Abigail-II's regex only handles the case of deletions. To support insertions and modifications, you need a more robust approach. _____________________________________________________ Jeff`[japhy]`Pinyan: Perl, regex, and perl hacker, who'd like a job (NYC-area) `s++=END;++y(;-P)}y js++=;shajsj<++y(p-q)}?print:??;`	[reply]
Re^4: non-exact regexp matches by vinforget (Beadle) on Jun 25, 2004 at 16:37 UTC
Thanks Jeff. I think I read up some more on advanced regexp before i get in over my head. Vince	[reply]