#!/usr/bin/perl -w
use strict;
use Bio::SeqIO;

my $file = $ARGV[0];
open INFILE, "<$file" or die "$0:  Can't open file $file: $!";

for (my $trial = 1; $trial <=2; $trial++)
{
   seek(INFILE,0,0); #This is line 10
   print "Trial $trial\n";

   my $i =1;
   my $in = Bio::SeqIO->new(-format => 'fasta', -fh => \*INFILE);

   while( my $seq = $in->next_seq  ) {
      print $i++, " : ", $seq->seq(), "\n";
   }

}
[download]

Trial 1
1 : TGCAATCACTAGCAAGCTCTCGCTGCCGTCACTAGCCTGTGG
2 : GGGGCTAGGGTTAGTTCTGGANNNNNNNNNNNNNNNNNNNNN
seek() on closed filehandle INFILE at test.pl line 10.
Trial 2
readline() on closed filehandle INFILE at /usr/lib/perl5/site_perl/5.8
+.0/Bio/Root/IO.pm line 440.
[download]

Then open the file within the for-loop:



#!/usr/bin/perl -w
use strict;
use Bio::SeqIO;

my $file = $ARGV[0];

for (my $trial = 1; $trial <=2; $trial++)
{
   open INFILE, "<$file" or die "$0:  Can't open file $file: $!";
   seek(INFILE,0,0); #This is line 10
   print "Trial $trial\n";

   my $i =1;
   my $in = Bio::SeqIO->new(-format => 'fasta', -fh => \*INFILE);

   while( my $seq = $in->next_seq  ) {
      print $i++, " : ", $seq->seq(), "\n";
   }

}
[download]

Thanks so much for the answer reneeb.

But as I stated in my 2nd posting of this thread. We don't need both. Namely, we don't even need "seek" function at all,
if we put "open INFILE.." within for-loop. It will work, that I know.

Forgive me if I sound nitpicking. But I just wonder if we can do
something by keeping "open" function outside for-loop,
while maintaining "seek" within? Would it be more efficient?


Regards,
Edward

Running the while loop

while( my $seq = $in->next_seq  ) {
      print $i++, " : ", $seq->seq(), "\n";
   }
[download]

will read until the end of the filehandle. (That is why the loop ended in the first place). So subsequently calling next_seq on the $in object will give you the error mesg you are seeing. You can
1. open SeqIO object outside of trial loop, and put seek(INFILE,0) inside the loop. Note that if the SeqIO object gets destroyed (or goes out of scope), you will need to add the flag -noclose => 1 option when initing the SeqIO object or else the filehandle is closed. But if you are going to do this, just move the initialization of the SeqIO object outside the loop.
2. re-open the file each time in the list (move the Bio::SeqIO initialization into the trial loop)
3. Or read all the sequences in at once and keep them in memory. (put them into an array).

   my @seqs; 
   while(my $s = $in->next_seq ) { push @seqs, $s; }
   # now do your loop of trials
   [download]

#3 might not work depending on how many sequences and how big they are.

stajich: you will need to add the flag -noclose => 1 option when initing the SeqIO object or else the filehandle is closed. But if you are going to do this, just move the initialization of the SeqIO object outside the loop.

Thanks stajich, it works ok now. But it will work with just adding the *-noclose=>1* flag. So this will just work fine:

#!/usr/bin/perl -w
use strict;
use Bio::SeqIO;

my $file = $ARGV[0];
open INFILE, "<$file" or die "$0:  Can't open file $file: $!";

for (my $trial = 1; $trial <=2; $trial++)
{
   seek(INFILE,0,0);
   print "Trial $trial\n";

   my $i =1;
   my $in = Bio::SeqIO->new(-format => 'fasta', -noclose => 1, -fh => 
+\*INFILE);
   while( my $seq = $in->next_seq()  ) {
      print $i++, " : ", $seq->seq(), "\n";
   }

}
[download]

I don't understand why we still need to move the initialization of the seqIO outside the loop?



Regards,
Edward

PS: BTW, I can't find any documentation of the -noclose flag in Bio::SeqIO perldoc. Where can I find that?