Re: HTML coded for in PERL

Yes Sorry.

The $counter is as it sounds a counter, whcih is taken from an external sub foreach loop.
The $recSite is a string variable showing the recognition site for an enzyme cleavage location i.e G^ATATGAG.
The $anotate is another string that shows the binding site of an enzyme in a DNA sequence i.e AGTATACGTTCAACGCA
The @cut is an array of fragments cut by the enzyme at the $recSite position, highlighted by the $anotate sequence.

Comment on Re: HTML coded for in PERL

Replies are listed 'Best First'.
Re^2: HTML coded for in PERL by davidrw (Prior) on May 18, 2005 at 17:13 UTC
Right, but what are the exact values (especially for @cut)? Can you provide the actual generated HTML that's too wide? I suspect (as some of the other responders have, too) that @cut has some big long chunk of whitespace-less text in it.	[reply]
Re^3: HTML coded for in PERL by MonkPaul (Friar) on May 18, 2005 at 17:19 UTC
The output for @ cut would be something like `Digested:AGCTGACGTCG AATTCGCAGGTCAGTACTACGTCGAGTACGGTACTGGACGTACGTGCAT +GTGTGTACGTGACTTACGTGACTGATCGATCGACGTAGCTGTTGTGTACTACTATCGATCGTACTTACT +GATGCTATATATTAGCGCGCTGCGTAGCTAGTCGCTATCGTGA` [download]	[reply] [d/l]
Re^4: HTML coded for in PERL by Transient (Hermit) on May 18, 2005 at 17:20 UTC
Yea, you'll definitely need to insert some whitespace in that thing if you want it to break in HTML.	[reply]
Re^4: HTML coded for in PERL by jeffa (Bishop) on May 18, 2005 at 18:39 UTC
Transient, davidrw, and frodo72 are correct. The lack of whitespace is causing the browser stretch. In fact, your sample output caused this very page to stretch until i edited your post and added <code> tags. Try something like this to add spaces at every, say 25 characters: `s/(.{25})/$1 /g for @cut;` [download] I would then use a bulleted list to display the elements of @cut, to make sure that whomever is reading the HTML page does not think they are seperate elements. `print "<ul>\n"; print "<li>$_</li>\n" for @cut; print "</ul>\n";` [download] Although i'd much rather use something like HTML::Template. jeffa L-LL-L--L-LL-L--L-LL-L-- -R--R-RR-R--R-RR-R--R-RR B--B--B--B--B--B--B--B-- H---H---H---H---H---H--- (the triplet paradiddle with high-hat)	[reply] [d/l] [select]