Re^2: Perl Parser, need help

#!/your/perl/here
use strict;
use warnings;
my $sequence;

while (my $line = <>)
{
# Sequence keyword
if ($line =~ /^Sequence:\s+(contig\d+)/)
{
$sequence = $1; # save the sequence
next;
}

# Parameter keyword
#next if ($line =~ /^Parameters:\s+(.*)$/)

# print any other non-blank lines
if ($line != /^\s*$/)
{
print "$sequence $line";
next;
}
}

QM..

I have tried your script, before i mark the parameter keyword out, the script have compilation error at line 24. After i mark that line, i manage to run the script with error, the compiler stated : isn't numeric in numeric ne (!=) at trf.pl line 19. But I still manage to get the output, after edited in excel. But funny thing is that, for those result starting from 1 (eg: 1 45 7 6.4 7 97 0 72 35 44 4 15 1.67 CCTAAAC CCTAAACCCTAAACCCTAAACCCTAAACCCTAAGCCCTAAGCCCT, it won't show in the parsed result... i wonder what's with this.. but anyway thank u so much!

Comment on Re^2: Perl Parser, need help

Replies are listed 'Best First'.
Re^3: Perl Parser, need help by QM (Parson) on May 19, 2005 at 22:37 UTC
I did mention that it was untested. That line is missing a terminating semicolon, fixed. -QM -- Quantum Mechanics: The dreams stuff is made of	[reply]
Re^4: Perl Parser, need help by joomanji (Acolyte) on Jun 02, 2005 at 07:26 UTC
Hi QM.. thanks for everything! After some modification on the matching of the "Sequence : Contig.." part, the script finally working! I disable the warning output, so it looks abit nicer when running the script.. here is the modified one. Thank u again QM! And thanks to everyone who helped! #!/bin/perl/ my $sequence; while (my $line = <>) { # Sequence keyword if ($line =~ /^Sequence:\s+(\S+)/) { $sequence = $1; # save the sequence next; } # Parameter keyword next if ($line =~ /^Parameters:\s+(.*)$/); # print any other non-blank lines if ($line != /^\s+$/) { print "$sequence $line"; next; } } Thanks again everyone!	[reply]
Re^5: Perl Parser, need help by QM (Parson) on Jun 02, 2005 at 12:46 UTC
I disable the warning output, so it looks abit nicer when running the script. You mean you removed `strict` and `warnings` ??? I can't check it where I am right now, but I don't see anything that would cause you problems, unless you're running on a very old or customized Perl. Perhaps you could relate what warnings you're getting, and we might convince you to put `strict` and `warnings` back in? Or perhaps it's related to your larger script, and not to this minimal example? -QM -- Quantum Mechanics: The dreams stuff is made of	[reply] [d/l] [select]