Mechanize Problems

Anonymous Monk has asked for the wisdom of the Perl Monks concerning the following question:

For some unknown reasons the site that I want to post isn't posted. But I dont figure out why. Thank you for any advice.

my $url = URI->new("http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi");
$mech->get($url);
if($mech->success())
            {
                $mech->form_number(1);
                $mech->set_fields(
                            name        => "$names[$num]",
                            Sequence    => "$lines[$num]",
                            pffold        => "pf",
                            Params        => "RNA",
                            Temp        => "37",
                            email        => 'KaiAllard@web.de'
                         );
                $mech->untick(toggles => "-4");
                          $mech->untick(toggles => "-d");
                                $mech->tick(toggles => "-noCloseGU");
                $mech->tick(toggles => "-noLP");
                $mech->untick(plot => "on");
                $mech->untick(SVG => "on");
                $mech->untick(SSview => "on");
                $mech->click_button(value => "Fold it");
                if($mech->success())
                { ... do something
[download]

At this point I just get the original page but not the following page that I want to reach. I dont get any warning or something... But it seams that I dont post the page. There is only one case that the real page does return to its original: no "Sequence"...

Comment on Mechanize Problems Download Code

Replies are listed 'Best First'.
Re: Mechanize Problems by planetscape (Chancellor) on Dec 13, 2005 at 10:37 UTC
My boilerplate advice is this: I would try using a module such as HTTP::Recorder or WWW::Mechanize::Shell to record a successful manual form submission. The output of HTTP::Recorder, for instance, can be "dropped" right into your WWW::Mechanize scripts. Another important tool for finding out what is really happening behind the scenes between server and browser is a protocol analyzer such as Ethereal. Don't forget that Super Search is your friend here on PM. Many questions such as yours have been asked recently... Good luck, planetscape	[reply]
Re^2: Mechanize Problems by Anonymous Monk on Dec 14, 2005 at 17:58 UTC
Thank you. I tried Mech::Shell. A very nice tool. But unfortunately it generates the code I wrote (a bit different of course) with the same problem. Well never ind I have to accept that the site I want to reach must have a subtil bug.	[reply]
Re^3: Mechanize Problems by planetscape (Chancellor) on Dec 14, 2005 at 20:17 UTC
Some experimentation with HTTP::Recorder suggests that what you want in place of `$mech->click_button(value => "Fold it");` is instead: `$mech->click('Action');` : `$agent->get('http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi'); $agent->form_number(1); $agent->tick('toggles', '-noLP'); $agent->field('name', 'fakename'); $agent->tick('SVG', 'on'); $agent->field('email', name@domain.com'); $agent->field('Temp', '37'); $agent->tick('plot', 'on'); $agent->field('Params', 'RNA'); $agent->field('Sequence', 'GATTACAGATTACAGATTACA'); $agent->field('pffold', 'pf'); $agent->click('Action');` [download] (HTTP::Recorder records scripts using "$agent" instead of "$mech".) Viewing the HTML source of the page in question would have revealed your error: `<input type="hidden" name="rec-form1-submit-Action" value=1> <input type="submit" name="Action" value="Fold it"> ^^^^^^` [download] HTH, planetscape	[reply] [d/l] [select]
Re: Mechanize Problems by gu (Beadle) on Dec 12, 2005 at 18:51 UTC
As mech-dump indicates that the button you are clicking is the submit button, instead of clicking the button I would use the submit function from WWW::Mechanize, as follows : `... $mech->untick(SSview => "on"); $mech->submit; die $mech->res->status_line unless $mech->success ; my $uri = $mech->response->request->uri->as_string ; print $uri ;` [download] Is it better ? We discussed form submitting in how to submit html form?. Hope this helps. Gu	[reply] [d/l]
Re^2: Mechanize Problems by Anonymous Monk on Dec 12, 2005 at 18:57 UTC
Thank you for your effort... but it was my first thought. No sorry there is no improvement... For some reason the post is a kind of success but just returns to the original page, no matter if submit or button, or if I do some hardcoding... always the same result. I am lost.	[reply]