Re: Click button not working in WWW::Mechanize

I commented out this line:

#$mech->submit();
[download]

and got:

---------- Capture Output ----------
> "c:\perl\bin\perl.exe" _new.pl
<html><title>ARG1</title>
<body bgcolor=white>
<h2 align=center>ARG1</h2><hr>
<form method="post" action="/cgi-bin/SCPD/getgene2?ARG1" enctype="appl
+ication/x-www-form-urlencoded">
<input type="submit" name="action" value="Get mapped sites" /><input t
+ype="submit" name="action" value="Get putative sites" /><input type="
+submit" name="action" value="Get intergenic region" /><br /><input ty
+pe="submit" name="action" value="Retrieve sequence" />Start<-ATG <inp
+ut type="text" name="start" value="-450" size="5" maxlength="5" />ATG
+->End <input type="text" name="end" value="50" size="5" maxlength="5"
+ /><div></div></form><hr>
<pre>
>YOL058W  ARG1  218759  219259
CGAGCTTTTTCACTGCAGTAATTCTCCACATGGGCCCAGCCACTGAGATA
AGAGCGCTATGTTAGTCACTACTGACGGCTCTCCAGTCATTTATGTGATT
TTTTAGTGACTCATGTCGCATTTGGCCCGTTTTTTTCCGCTGTCGCAACC
TATTTCCATTAACGGTGCCGTATGGAAGAGTCATTTAAAGGCAGGAGAGA
GAGATTACTCATCTTCATTGGATCAGATTGATGACTGCGTACGGCAGATA
GTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGTCTCAATAGTAT
ATTAATGGGCATACATTCGTACTCCCTTGTTCTTGCCCACAGTTCTCTCT
CTCTTTACTTCTTGTATCTTGTCTCCCCATTGTGCAGCGATAAGGAACAT
TGTTCTAATATACACGGATACAAAAGAAATACACATAATTGCATAAAATA
ATGTCTAAGGGAAAAGTTTGTTTGGCTTATTCTGGTGGTTTAGATACCTC

> Terminated with exit code 0.
[download]

From the docs:

$mech->submit()
Submits the page, without specifying a button to click. Actually, no button is clicked at all.

Comment on Re: Click button not working in WWW::Mechanize Select or Download Code

Replies are listed 'Best First'.
Re^2: Click button not working in WWW::Mechanize by mbarbosa (Initiate) on Sep 21, 2006 at 10:25 UTC
yup, monkfan was submitting the form twice and collecting the content only after the submit that did not matter.	[reply]
Re^2: Click button not working in WWW::Mechanize by monkfan (Curate) on Sep 21, 2006 at 12:05 UTC
Strange wfsp, I tried to comment out "$mech->submit()" but it still does not give the result as you get (i.e. same old output). Did you use the exact code I have in my OP? BTW I am running under Linux, could it bet the case? `Linux myhost.com.sg 2.6.9-34.ELsmp #1 SMP Fri Feb 24 16:54:53 EST 2006 + i686 i686 i386 GNU/Linux` [download] Regards, Edward	[reply] [d/l]
Re^3: Click button not working in WWW::Mechanize by wfsp (Abbot) on Sep 21, 2006 at 12:11 UTC
Sorry, forgot to mention that I also removed: `name => "action",` [download] because all the buttons had that name. `#!/usr/bin/perl use warnings; use strict; use WWW::Mechanize; my $mech = WWW::Mechanize->new(); my $tf_add = "http://rulai.cshl.edu/cgi-bin/SCPD/getgene2?ARG1"; $mech->get($tf_add); $mech->set_fields( 'start' => -450, 'end' => 50 ); # this part works # but not this: $mech->click_button( value => "Retrieve sequence" ); #$mech->submit(); my $result = $mech->content(); print "$result\n";` [download]	[reply] [d/l] [select]