Sorting strings

uvnew has asked for the wisdom of the Perl Monks concerning the following question:

Hey guys. I have about 500 DNA sequences, each one consists of an ID and sequence letters, and a line space between each sequence. I need to rearrange the sequences according to their ID number, in ascending order. The ID for every sequence is the ENSP00000xxxxx So if for example my original sequences file is:

>ENSP00000314624
GCACAATGGTAGAGGCAGATCATCC

>ENSP00000347089
ATGGATTGCTGTGCCTCTCGAGGCT

>ENSP00000301587
TGACCCACTTCCGTTACTTGCTGCG
[download]

then I would like it to be:

>ENSP00000301587
TGACCCACTTCCGTTACTTGCTGCG

>ENSP00000314624
GCACAATGGTAGAGGCAGATCATCC

>ENSP00000347089
ATGGATTGCTGTGCCTCTCGAGGCT
[download]

I would truly appreciate any suggestion.

Cheers,

Comment on Sorting strings Select or Download Code

Replies are listed 'Best First'.
Re: Sorting strings by ikegami (Patriarch) on Jan 25, 2007 at 17:33 UTC
Since the number of right-padded with zeroes, sorting in plain old lexical order will do the trick. `my @unsorted = ( '>ENSP00000314624 GCACAATGGTAGAGGCAGATCATCC', '>ENSP00000347089 ATGGATTGCTGTGCCTCTCGAGGCT', '>ENSP00000301587 TGACCCACTTCCGTTACTTGCTGCG', ); my @sorted = sort @unsorted; print("$_\n") foreach @sorted;` [download] Ref: sort Update: My post was written when the OP wasn't formatted. It wasn't evidentant that there were line breaks in the data. The answer is still the same, however. The key is to create an array of records instead of an array of lines. mreece shows one way of doing this.	[reply] [d/l]
Re: Sorting strings by shigetsu (Hermit) on Jan 25, 2007 at 17:36 UTC
As a side note: Have you considered using bioperl?	[reply]
Re: Sorting strings by mreece (Friar) on Jan 26, 2007 at 02:26 UTC
you can set the input record separator to `\n\n` to read the paragraph format you have there. then the default sort will work, if the prefix is the same on every line. `#!perl use strict; use warnings; my @data; { local $/ = "\n\n"; @data = <DATA>; } my @sorted = sort @data; print @sorted; __DATA__ >ENSP00000314624 GCACAATGGTAGAGGCAGATCATCC >ENSP00000347089 ATGGATTGCTGTGCCTCTCGAGGCT >ENSP00000301587 TGACCCACTTCCGTTACTTGCTGCG` [download] produces >ENSP00000301587 TGACCCACTTCCGTTACTTGCTGCG >ENSP00000314624 GCACAATGGTAGAGGCAGATCATCC >ENSP00000347089 ATGGATTGCTGTGCCTCTCGAGGCT	[reply] [d/l] [select]
Re^2: Sorting strings by uvnew (Acolyte) on Jan 26, 2007 at 12:55 UTC
Thanks a lot, that works perfectly! Can you recommend a good tutorial for regular expressions? I think I really need that... Cheers, uv	[reply]