In any case, you really should use strict since now your empty string is being interpolated as a subroutine name (i.e. a soft reference) instead of throwing an error because it's not a real subref.

Why do you make us waste our time verifying and fixing POC code accompanying your question?

It gives me a undefined subroutine &main:: called at ... error

Scalar found where operator expected at foo.pl line 2, near ")
[download]

because of the "(yes I know....)" comment which isn't a comment. Fixing that,

syntax error at foo.pl line 4, near "..."
[download]

it chokes on ".... some code .....".

Please! Either post runnable code, or post something along with it like "this code doesn't run, can you help me fix it?"

Cleaning up your code to the point where it is at least runnable, I get

#!/usr/bin/perl -l

$a = sub {return @_[0]};
$b = sub {return @_[0]+1};

if (0) {
   $i = $a;
} else {
   $i = $b;
}  

$number = 10;
print &lala ($i);

sub lala{
   my $i = $_[0];
   $res = &{$i}($number) ;
   #have also tried $res = $i->($number) with the same result
}  
__END__
11
[download]

which is kinda what I expected, and whithout errors.

There are major flaws with your code. Use strict, don't use $a and $b and so on. But now I've spent the time I had for that just to make your piece of code runnable - so sorry, others may hint you at those.

_($_=" "x(1<<5)."?\n".q·/)Oo.  G°\        /
                              /\_¯/(q    /
----------------------------  \__(m.====·.(_("always off the crowd"))."·
");sub _{s./.($e="'Itrs `mnsgdq Gdbj O`qkdq")=~y/"-y/#-z/;$e.e && print}

Sorry, wrong version, the code I meant to post was:

#!/usr/bin/perl

$fileName = "tmp.txt";

open(CPF, $fileName) or die ("Can't open file ", $fileName);
@lines = <CPF>;
close (CPF);

$index = 0;
@allNames;
@allSeq;
$nbTaxa;
$nbGenes;
#$lastLine = "start";        

$alternatingIter = sub {return $_[0]};
$followedIter = sub {return (($_[0] % 10) - 1) };
$iter;


chop $lines[0];
($nbTaxa,$nbGenes)=split / +/, $lines[0];    
print $nbTaxa." ".$nbGenes."\n";


&sorter ($lines[1]);

($first, $second)= split / +/, $lines[2];

if (((length $second) == 0) && ($first =~ /[AGTC]+/)){    
    $iter = $followedIter;
    chop ($first);
    $allSeq[$index]= $allSeq[$index].$first;

    print "TYPE: just sequence  -->  ";
    print "first:".$first.";  second:".$second.";\n";
}


elsif (((length $second) > 0) && ($first =~ /(\w)+/) &&  ($second =~ /
+[AGTC]+/) ){    
    $iter = $alternatingIter;
    $allNames [$index] = $first;
    chop ($second);
    $allSeq [$index] = $second;
    $index++;

    print "TYPE: name + sequence -->  ";
    print "first:".$first.";  second:".$second.";\n";
    }

foreach $tmp (@lines[3..@lines]){
    &sorter ($tmp, $iter);
}

for ($i = 0; $i <= $index; $i++){
    print $allNames[$i]." -->  ".$allSeq[$i]."\n";
}

sub sorter {
    my $tmp = $_[0];
    my $iter = $_[1];
    ($first, $second)= split / +/, $tmp;

    if (((length $second) == 0) && ($first =~ /[AGTC]+/)){
        chop ($first);
        $allSeq[$iter]= $allSeq[$index].$first;
        $index++;

        print "TYPE: just sequence  -->  ";
        print "first:".$first.";  second:".$second.";\n";
    }


    elsif (((length $second) > 0) && ($first =~ /(\w)+/) &&  ($second 
+=~ /[AGTC]+/) ){
        $i = &{$iter}($index);    # ou $iter->($index);
        $allNames [$i] = $first;
        chop ($second);
        $allSeq [$i] = $second;
        $index++;

        print "TYPE: name + sequence -->  ";
        print "first:".$first.";  second:".$second.";\n";
    }
    elsif($first eq "\n"){
        print "TYPE: do nothing -->  ";
        print "first:".$first.";  second:".$second.";\n";
    }
    else{
        print "TYPE: you have a problem with the format of file".$file
+Name." -->  ";
        print "first:".$first.";  second:".$second.";\n";
    }
    print "index: ".$index."\n";
}
[download]

Here is the tmp.txt file you should use as input

10  705
Cow       ATGGCATATCCCATACAACTAGGATTCCAAGATGCAACATCACCAATCATAGAAGAACTA
Carp      ATGGCACACCCAACGCAACTAGGTTTCAAGGACGCGGCCATACCCGTTATAGAGGAACTT
Chicken   ATGGCCAACCACTCCCAACTAGGCTTTCAAGACGCCTCATCCCCCATCATAGAAGAGCTC
Human     ATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAGAAGAGCTT
Loach     ATGGCACATCCCACACAATTAGGATTCCAAGACGCGGCCTCACCCGTAATAGAAGAACTT
Mouse     ATGGCCTACCCATTCCAACTTGGTCTACAAGACGCCACATCCCCTATTATAGAAGAGCTA
Rat       ATGGCTTACCCATTTCAACTTGGCTTACAAGACGCTACATCACCTATCATAGAAGAACTT
Seal      ATGGCATACCCCCTACAAATAGGCCTACAAGATGCAACCTCTCCCATTATAGAGGAGTTA
Whale     ATGGCATATCCATTCCAACTAGGTTTCCAAGATGCAGCATCACCCATCATAGAAGAGCTC
Frog      ATGGCACACCCATCACAATTAGGTTTTCAAGACGCAGCCTCTCCAATTATAGAAGAATTA

CTTCACTTTCATGACCACACGCTAATAATTGTCTTCTTAATTAGCTCATTAGTACTTTAC
CTTCACTTCCACGACCACGCATTAATAATTGTGCTCCTAATTAGCACTTTAGTTTTATAT
GTTGAATTCCACGACCACGCCCTGATAGTCGCACTAGCAATTTGCAGCTTAGTACTCTAC
ATCACCTTTCATGATCACGCCCTCATAATCATTTTCCTTATCTGCTTCCTAGTCCTGTAT
CTTCACTTCCATGACCATGCCCTAATAATTGTATTTTTGATTAGCGCCCTAGTACTTTAT
ATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTAT
ACAAACTTTCATGACCACACCCTAATAATTGTATTCCTCATCAGCTCCCTAGTACTTTAT
CTACACTTCCATGACCACACATTAATAATTGTGTTCCTAATTAGCTCATTAGTACTCTAC
CTACACTTTCACGATCATACACTAATAATCGTTTTTCTAATTAGCTCTTTAGTTCTCTAC
CTTCACTTCCACGACCATACCCTCATAGCCGTTTTTCTTATTAGTACGCTAGTTCTTTAC
[download]

Several problems here. Use warnings and strict!
Your error is because you are calling 'sorter' on line 26 with only one argument - you are not passing it an '$iter'.
It is a bad idea to have a local variable and a global of the same name - very confusing ($iter).
The syntax for calling the ref should be &$iter($index)
I also spotted that your foreach loop is wrong, use $#lines for the highest index, @lines will go one element beyond the end of the array (it give s the number of elements).
Probably more errors lurking, but that should do for now.
update: $allSeq[&$iter()]= $allSeq[$index].$first;I really hate your use of globals in the subroutine, sorry, but it makes the code difficult to figure out. Should your $first and $second in sorter() overwrite the globals?

I'm sorry if I made waste your time but (as I replied above) it wasn't possible for me to copy&paste the code. Also I thought it was really basic error that didn't require running to sort out since the problem is I don't know very well how to use references to functions.But I thank you for trying to fix it anyway, not everybody would do that. If the actual code is more usefull for you here it is:

#!/usr/bin/perl

$fileName   = $ARGV[0];
$windowSize = $ARGV[1];
$windowIncrement = $ARGV[2];

open(CPF, $fileName) or die ("Can't open file ", $fileName);
@lines = <CPF>;
close (CPF) or warn ("Unable to close ", $fileName);
$n = @lines;

$index = 0;
@allNames;
@allSeq;
$nbTaxa;
$nbGenes;
#$lastLine = "start";

$alternatingIter = sub {return $_[0]};
$followedIter = sub {return (($_[0] % 10) - 1) };
$iter;

chop $lines[0];
($nbTaxa,$nbGenes)=split / +/, $lines[0];    

&sorter ($lines[1]);


    if (((length $second) == 0) && ($first =~ /[AGTC]+/)){    
        $iter = $followedIter;
        chop ($first);
        $allSeq[$index]= $allSeq[$index].$first;

        print "TYPE: just sequence  -->  ";
        print "first:".$first.";  second:".$second.";\n";
    }


    elsif (((length $second) > 0) && ($first =~ /(\w)+/) &&  ($second 
+=~ /[AGTC]+/) ){    
        $iter = $alternatingIter;
        $allNames [$index] = $first;
        chop ($second);
        $allSeq [$index] = $second;
        $index++;

        print "TYPE: name + sequence -->  ";
        print "first:".$first.";  second:".$second.";\n";
    }

foreach $tmp (@lines[3..@lines]){
    &sorter ($tmp);
}


sub sorter {
    $tmp = $_[0];
    ($first, $second)= split / +/, $tmp;

    if (((length $second) == 0) && ($first =~ /[AGTC]+/)){    
        chop ($first);
        $allSeq[$index]= $allSeq[$index].$first;

        print "TYPE: just sequence  -->  ";
        print "first:".$first.";  second:".$second.";\n";
    }


    elsif (((length $second) > 0) && ($first =~ /(\w)+/) &&  ($second 
+=~ /[AGTC]+/) ){    
        $allNames [$index] = $first;
        chop ($second);
        $allSeq [$index] = $second;
        $index++;

        print "TYPE: name + sequence -->  ";
        print "first:".$first.";  second:".$second.";\n";
    }
    elsif($first eq "\n"){
        print "TYPE: do nothing -->  ";
        print "first:".$first.";  second:".$second.";\n";
    }
    else{
        print "TYPE: you have a problem with the format of file".$file
+Name." -->  ";
        print "first:".$first.";  second:".$second.";\n";
    }
    print "index: ".$index."\n";
}
[download]

I've cutted the parts that don't have anything to do with the problem so I'm almost certain it will run. Still, the problem is the same (using the iter reference) as i didn't understand what you fixed.

Then $i contains the empty string and the code isn't doing what you think it is. Look at the rest of the code more closely. We can't because you didn't include the actual code (just what you thought the code was). (:

Thanks for the tip on the empty string.Then how should i do to make 1. an anonymous subroutine (is the $a and $b assigments ok for that?)2. Assign the reference of one of the anonymous subroutines to another variable.And 3. use this last variable to call the subroutine and pass arguments.

$a = sub {return @_[0]}; (yes I know....)
[download]

I meant $_[0], the yes I know was for writing stupid code.The error was because I have to hand copy the code from one pc to another because one doesn't have internet.

I meant $_[0], the yes I know was for writing stupid code.

The error was because I have to hand copy the code from one pc to another because one doesn't have internet.

The biggest error being not that of using @_[0] instead of $_[0], which is valid syntax and fundamentally does the right thing, but that of not putting the "yes I know..." part behind a comment sign, which does not.