Anonymous Monk has asked for the wisdom of the Perl Monks concerning the following question:
I have attached my code along with this: I couldn.t really get what the problem is as far as I understand there should be 'something wrong ' with the line, my $blast_report = $blast->blastall($input); but may be the $blast could n't get the file s?????the small rnas:CAGCGATGGGGATCAAGCTC the sequnce thats being worked is CAGCGATGGGGATCAAGCTC [blastall] WARNING: Unable to open TCV-jagger.fna.nin [blastall] WARNING: : Unable to open TCV-jagger.fna.nin ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: blastall call crashed: 256 /usr/bin/blastall -p blastn -d "/va +r/common/CGI-BIN/TCV-jagger.fna" -i /tmp/Qs5Y9sAFLK -o /tmp/Rk2tt +OzUih STACK: Error::throw STACK: Bio::Root::Root::throw /usr/local/share/perl/5.8.8/Bio/Root/Roo +t.pm:328 STACK: Bio::Tools::Run::StandAloneBlast::_runblast /usr/local/share/pe +rl/5.8.8/Bio/Tools/Run/StandAloneBlast.pm:759 STACK: Bio::Tools::Run::StandAloneBlast::_generic_local_blast /usr/loc +al/share/perl/5.8.8/Bio/Tools/Run/StandAloneBlast.pm:706 STACK: Bio::Tools::Run::StandAloneBlast::blastall /usr/local/share/per +l/5.8.8/Bio/Tools/Run/StandAloneBlast.pm:557 STACK: aligning.pl:34
If any one could give a suggestion for this, that would be very helpful.#!/usr/bin/perl -w use strict; use Bio::SeqIO; use Bio::Tools::Run::StandAloneBlast; my %srna; my %genome; my $seqio_srna = Bio::SeqIO->new(-file=>'/home/jayakuma/script/graphic +s/model2.fasta', -format=>'fasta') or die "cannot open file\n"; my $seqio_large = Bio::SeqIO->new(-file => '/home/jayakuma/script/grap +hics/TCV-jagger.fna', -format =>'fasta') or die " cannot opne the file\n"; while (my $large_seq = $seqio_large->next_seq()){ my $id = $large_seq->display_id; my $seq = $large_seq->seq; $genome{$id} = $seq; } while (my $seq_srna = $seqio_srna->next_seq()){ my $display_id = $seq_srna->display_id; my $seq = $seq_srna->seq; $srna{$display_id} = $seq; } foreach my $seq_id (keys %srna){ my $srnas = $srna{$seq_id}; #print "srnas: $srnas\n"; foreach($srnas){ print "the small rnas:$srnas", "\n"; my $blast = Bio::Tools::Run::StandAloneBlast->new(program => 'blas +tn', database => 'var/common/CGI-BIN/TCV-jagger.fna'); my $input = Bio::Seq->new(-seq=> $srnas); print "the sequnce thats being worked is ", $input->seq, "\n"; my $blast_report = $blast->blastall($input); while (my $result = $blast_report->next_result()){ my $query_length = $result->query_length(); while (my $hit = $result->next_hit()){ my $id = $hit->accession(); while (my $hsp = $hit->next_hsp()){ if($hsp->frac_identical ==1 && $hsp ->length ==$query_leng +th){ print "srna:$srnas\t$id\n"; } } } } } }
|
|---|
| Replies are listed 'Best First'. | |
|---|---|
|
Re: blast crashed
by samtregar (Abbot) on Mar 25, 2008 at 17:03 UTC | |
|
Re: blast crashed
by bobf (Monsignor) on Mar 26, 2008 at 02:12 UTC | |
by Anonymous Monk on Mar 26, 2008 at 16:53 UTC |