Re: compare a list from one file with another text file

A slightly different approach than that suggested by igelkott: first read in your first file and store the keys in a hash (of arrays). Then read the second file and store the sequence in the hash if the hash has a matching key.

use strict;
use warnings;
use Data::Dumper;
use Fatal qw[open];

my %key;

open my $data, '<', 'data.txt';
while(<$data>) {
    chomp;
    $key{$_} = [];
} 

my %line; 
open my $all, '<', 'all.txt';
while(<$all>) {
    chomp;
    $line{key} = $_;
    $line{seq} = <$all>; # read the sequence
    chomp $line{seq};
    my ($key) = ($line{key} =~ /(Contig\d*)/);
    if(exists $key{$key}) {
        push @{$key{$key}}, $line{seq};
    } 
} 
print Dumper(\%key) ."\n";
[download]

with data.txt and all.txt as given this produces:

$VAR1 = {
          'Contig25396' => [
                             'GGGATCTTTGGACGAAGGGGGGAAAAAGATGTCAACTTTA
+AGCATTCCAC CAATGCTTACTTCCCCTAGAGATGATGCCATTCAACTGTACAAGGCTTTC AAGGGAT
+TTGGATGTGACACTTCTGCAGTAATCCATATCTTAGCTCGTCG'
                           ],
          'Contig25381' => [
                             'GGACGAGATTTAACGACATCCATAAGCAACTCTGCTAATC
+ATTCGATCTG CTTGGAGGTGTTTTTCCCCCATTTCCCTTAACCATGTCTCAGACTGTGGT'
                           ],
          'Contig25469' => [
                             'GGCTCTCTACCTATCTGTCTCTCTCTACCTCTCTCTCCTT
+TCACGCACAC'
                           ]
        };
[download]

Update: amended version per Re^2: compare a list from one file with another text file

use strict;
use warnings;
use Data::Dumper;
use Fatal qw[open];

my %key;

open my $data, '<', 'data.txt';
while(<$data>) {
    chomp;
    $key{$_} = 1;
} 

my %line; 
open my $all, '<', 'all.txt';
open my $out, '>', 'requery.txt';
while(<$all>) {
    chomp;
    $line{key} = $_;
    $line{seq} = <$all>; # read the sequence
    chomp $line{seq};
    my ($key) = ($line{key} =~ /(Contig\d*)/);
    if(exists $key{$key}) {
        print $out join("\n", $line{key}, $line{seq}) . "\n"; 
    } 
}
[download]

Comment on Re: compare a list from one file with another text file Select or Download Code

Replies are listed 'Best First'.
Re^2: compare a list from one file with another text file by sm2004 (Acolyte) on Apr 06, 2008 at 04:17 UTC
Thanks a lot for taking the time to write the code. I'm new to perl and do not quite understand statements like 'use Data::Dumper', but thanks so much for giving a solution.	[reply]