use Tk;

  $idea = 0;
  
  $rawSequence="atggcgacgaaggccgtgtgcgtgctgaagggcgacggcccagtgcagggcatc
+atcaatttcgagcagaaggaaagtaatggaccagtgaaggtgtggggaagcattaaaggactgactgaa
+ggcctgcatggattccatgttcatgagtttggagataatacagcaggctgtaccagtgcaggtcctcac
+tttaatcctctatccagaaaacacggtgggccaaaggatgaagagaggcatgttggagacttgggcaat
+gtgactgctgacaaagatggtgtggccgatgtgtctattgaagattctgtgatctcactctcaggagac
+cattgcatcattggccgcacactggtggtccatgaaaaagcagatgacttgggcaaaggtggaaatgaa
+gaaagtacaaagacaggaaacgctggaagtcgtttggcttgtggtgtaattgggatcgcccaataaaca
+ttcccttggatgtagtctgaggcccct";
  my $mainWindow = MainWindow->new();

  if( $idea)
  {
    # Main Window
    $mainWindow->title("Regex Problem Example 1");    
    $mainWindow->minsize(qw(500 500));  #Sets Minimum Size - note lack
+ of comma
    $mainWindow->geometry('+500+200');  #Sets Position - note lack of 
+comma
    $mainWindow->optionAdd('*font'=>'Courier 10');
  
    $ROText = $mainWindow->Scrolled('ROText',
                                -scrollbars=>'osoe');
  
    $formattedSequence = formatSequence($rawSequence);
    $ROText->Insert($formattedSequence);
    $ROText->pack;
    
    highlightText($ROText, "gca");
  }
  else
  {
    # Main Window
    $mainWindow->title("Regex Problem Example 2");    #Sets Title
    $mainWindow->minsize(qw(500 500));  #Sets Minimum Size - note lack
+ of comma
    $mainWindow->geometry('+500+200');  #Sets Position - note lack of 
+comma
    $mainWindow->optionAdd('*font'=>'Courier 10');
  
    $ROText = $mainWindow->Scrolled('ROText',
                                -scrollbars=>'osoe');
  
    $formattedSequence = searchAndFormatSequence($rawSequence);
    $ROText->Insert($formattedSequence);
    $ROText->pack;
    
    #This works, but I can't make Uppercase->Lowercase
    #without removing the tags.
    highlightText2($ROText, "[A-Z]+");
    
  }
MainLoop();


sub highlightText {
    my ($widget, $searchString) = @_;
 
    #alter search string - HOW?    
    
    # Create a tag to configure the text
    $widget->tagConfigure('foundtag',
                            -foreground => "white",
                            -background => "red");
    $widget->FindAll(-regex, -nocase, $searchString);
    if ($widget->tagRanges('sel'))
    {
        my %startfinish  = $widget->tagRanges('sel');
        foreach(sort keys %startfinish)
        {
            $widget->tagAdd("foundtag", $_, $startfinish{$_});
        }
        $widget->tagRemove('sel', '1.0', 'end');
    }
}

sub highlightText2 {
    my ($widget, $searchString) = @_;
 
    #alter search string - HOW?    
    
    # Create a tag to configure the text
    $widget->tagConfigure('foundtag',
                            -foreground => "white",
                            -background => "red");
    $widget->FindAll(-regex, -case, $searchString);
    if ($widget->tagRanges('sel'))
    {
        my %startfinish  = $widget->tagRanges('sel');
        foreach(sort keys %startfinish)
        {
            $widget->tagAdd("foundtag", $_, $startfinish{$_});
        }
        $widget->tagRemove('sel', '1.0', 'end');
    }
    #UNCOMMENT TO BREAK! Doesn't like a regex in the replace string
    #$widget->FindAndReplaceAll(-regex, -case, "G", "g");
    #$widget->FindAndReplaceAll(-regex, -case, "C", "c");
    #$widget->FindAndReplaceAll(-regex, -case, "A", "a");

}


sub searchAndFormatSequence
{
    #I search the sequence and change any gca in the sequence to GCA t
+hen
    #format the sequence, the end result of which is

    return "        1 atggcgacga aggccgtgtg cgtgctgaag ggcgacggcc cagt
+GCAggG CAtcatcaat
       61 ttcgaGCAga aggaaagtaa tggaccagtg aaggtgtggg gaaGCAttaa aggac
+tgact
      121 gaaggcctGC Atggattcca tgttcatgag tttggagata atacaGCAgg ctgta
+ccagt
      181 GCAggtcctc actttaatcc tctatccaga aaacacggtg ggccaaagga tgaag
+agagG
      241 CAtgttggag acttggGCAa tgtgactgct gacaaagatg gtgtggccga tgtgt
+ctatt
      301 gaagattctg tgatctcact ctcaggagac cattGCAtca ttggccGCAc actgg
+tggtc
      361 catgaaaaaG CAgatgactt ggGCAaaggt ggaaatgaag aaagtacaaa gacag
+gaaac
      421 gctggaagtc gtttggcttg tggtgtaatt gggatcgccc aataaacatt ccctt
+ggatg
      481 tagtctgagg cccct";
    
}


sub formatSequence
{
    #I do some really neat formatting here the end result of which is.
+..
    
    return "        1 atggcgacga aggccgtgtg cgtgctgaag ggcgacggcc cagt
+gcaggg catcatcaat
       61 ttcgagcaga aggaaagtaa tggaccagtg aaggtgtggg gaagcattaa aggac
+tgact
      121 gaaggcctgc atggattcca tgttcatgag tttggagata atacagcagg ctgta
+ccagt
      181 gcaggtcctc actttaatcc tctatccaga aaacacggtg ggccaaagga tgaag
+agagg
      241 catgttggag acttgggcaa tgtgactgct gacaaagatg gtgtggccga tgtgt
+ctatt
      301 gaagattctg tgatctcact ctcaggagac cattgcatca ttggccgcac actgg
+tggtc
      361 catgaaaaag cagatgactt gggcaaaggt ggaaatgaag aaagtacaaa gacag
+gaaac
      421 gctggaagtc gtttggcttg tggtgtaatt gggatcgccc aataaacatt ccctt
+ggatg
      481 tagtctgagg cccct";

}
[download]

Can't you just do the lowercasing before you apply the ranges (using the uppercase approach you outlined)?  The tag positions in %startfinish would still be valid, as the case has no influence on length...

        my %startfinish  = $widget->tagRanges('sel');

        # undo uppercase
        my $s = $widget->Contents();
        $s =~ tr/A-Z/a-z/;
        $widget->Contents($s);
        
        foreach(sort keys %startfinish)
        {
            $widget->tagAdd("foundtag", $_, $startfinish{$_});
        }
[download]

That would at least highlight all (lowercased) subsequences. But I'm still not entirely sure what the ultimate objective is... Is it just the highlighting?

That worked! Thank you much! To answer your question, the first goal is basically highlighting. What I eventually want to do with it is let a user type in the starting characters of a known piece of the sequence (which he gets from another source) until he gets one highlighted area. Then do the same thing for the last part of the sequence, then be able to take the area between the two highlighted sequences and do what's called a Blast, which tries to find that sequence in another species.