Problem with getting the right object

lomSpace has asked for the wisdom of the Perl Monks concerning the following question:

Hello,
I am having trouble getting my if-elsif-else to function as I would like.
The first part returns the name and percent_identity, but not the
actual dereferenced object. I need the name,percent_identity, and
the dereferenced glob object.

my $in = new Bio::SearchIO(-format => 'blast',
                           -file   => DATA,
                           -report_type => 'blastn');
    while(my $result = $in->next_result){
        if(my $hit = $result->next_hit){ 
            if(my $hsp = $hit->hsp('best')){
                if(my $hu_name = $hit->name){
                    open (my $hu_out,">".$maid_dir."\\".$maid."_hu_par
+sed.out");
                    $hu_name =~ /^>.*HU/;
                    my $hu_Percent_id = $hsp->percent_identity;
                    print $hu_out "Name: ", $hu_name, "\n";           
+         
                    print $hu_out "Percent Identity:  ", $hu_Percent_i
+d, "\n";
                    my $hu_aln = $hsp->get_aln;
                    #my $hu_aln_ref = \$hu_aln;
                    my $alnIO = Bio::AlignIO->new(-format =>"clustalw"
+, -file => ">$hu_out");
                    $alnIO->write_aln($hu_aln);
                    print $hu_out "Alignment:  ", $hu_aln, "\n";
                    close $hu_out;
                }
                elsif(my $hd_name = $hit->name)
                {
                    open (my $hd_out,">".$maid_dir."\\".$maid."_hd_par
+sed.out");
                    $hd_name = ~ /^>.*HD/;
                    my $hd_Percent_id = $hsp->percent_identity;
                    print $hd_out "Name: ", $hd_name, "\n";
                    print $hd_out "Percent Identity:  ", $hd_Percent_i
+d, "\n";
                    my $hd_aln = $hsp->get_aln;
                    #my $hd_aln_ref = \$hd_aln;
                    my $alnIO = Bio::AlignIO->new(-format =>"clustalw"
+, -file => ">$hd_out");
                    $alnIO->write_aln($hd_aln);
                    print $hd_out "Alignment:  ", $hd_aln, "\n";
                    close $hd_out;
                }
                else
                {
                    last;
                }
            }
        }
    }
__DATA__
BLASTN 2.2.20 [Feb-08-2009]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaff
+er, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database sear
+ch
programs",  Nucleic Acids Res. 25:3389-3402.

Query= i:\13426 Chchd1 (22)\sequencing\13426_fasta.Contig1
         (2477 letters)

Database: c:\blast_temp\hu_hdBLASTdb 
           2 sequences; 4150 total letters

Searching..................................................done



                                                                 Score
+    E
Sequences producing significant alignments:                      (bits
+) Value

13426|HU                                                              
+868   0.0  
13426|HD                                                              
+ 24   0.50 

>13426|HU
          Length = 2075

 Score =  868 bits (438), Expect = 0.0
 Identities = 441/442 (99%)
 Strand = Plus / Minus

                                                                      
+  
Query: 1163 ccattttgcacagcgttcccagtaggctccgcggcgccgtgcgtgacccctcttgacc
+tc 1222
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 1076 ccattttgcacagcgttcccagtaggctccgcggcgccgtgcgtgacccctcttgacc
+tc 1017

                                                                      
+  
Query: 1223 tacgcgcttggcgtgcggacaacgggcagctgtgcgcgcactttccgggtcttggcct
+ca 1282
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 1016 tacgcgcttggcgtgcggacaacgggcagctgtgcgcgcactttccgggtcttggcct
+ca 957

                                                                      
+  
Query: 1283 cggtgacactggattcgaaccccgtcgggccggcagccgacagcaggttaggatgcta
+ta 1342
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 956  cggtgacactggattcgaaccccgtcgggccggcagccgacagcaggttaggatgcta
+ta 897

                                                                      
+  
Query: 1343 ggttgtgcgcgccctttgcgtgctcgggacccggcaggattcaggggccccgtgtccg
+cg 1402
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 896  ggttgtgcgcgccctttgcgtgctcgggacccggcaggattcaggggccccgtgtccg
+cg 837

                                                                      
+  
Query: 1403 gctgccacttatttgtgagtcggtgtctgcgtgtgggcaccacgtgagtgccgcgtcc
+gt 1462
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 836  gctgccacttatttgtgagtcggtgtctgcgtgtgggcaccacgtgagtgccgcgtcc
+gt 777

                                                                      
+  
Query: 1463 ggcggccaggggaaggcgttggatcccatggggctggagttaaggattttggattgca
+aa 1522
            ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
+||
Sbjct: 776  ggcggccaggggaaggcgttggatcccgtggggctggagttaaggattttggattgca
+aa 717

                                                                      
+  
Query: 1523 ggacttttgttttaacaagtctgtgagaatgatgattccttttgccaggcggtggtga
+cg 1582
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 716  ggacttttgttttaacaagtctgtgagaatgatgattccttttgccaggcggtggtga
+cg 657

                                  
Query: 1583 ctcgcctttaaatcccggcact 1604
            ||||||||||||||||||||||
Sbjct: 656  ctcgcctttaaatcccggcact 635



 Score = 63.9 bits (32), Expect = 6e-013
 Identities = 70/80 (87%), Gaps = 2/80 (2%)
 Strand = Plus / Minus

                                                                      
+  
Query: 1731 tgctttttacatctcttacatggcctgctatgtagatcctcgttactcgtttgcaatg
+aa 1790
            ||||||||||| ||||||||||| |||||| |||||| ||  ||||||||||| ||||
+ |
Sbjct: 508  tgctttttacaactcttacatggactgctaggtagatactgtttactcgtttggaatg
+-a 450

                                
Query: 1791 tcgcaccagtagggggaacg 1810
            ||||| |||||||| |||||
Sbjct: 449  tcgca-cagtagggtgaacg 431



 Score = 28.2 bits (14), Expect = 0.032
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                          
Query: 2417 ctttattagatact 2430
            ||||||||||||||
Sbjct: 24   ctttattagatact 37



 Score = 24.3 bits (12), Expect = 0.50
 Identities = 12/12 (100%)
 Strand = Plus / Plus

                        
Query: 1587 cctttaaatccc 1598
            ||||||||||||
Sbjct: 1812 cctttaaatccc 1823



 Score = 22.3 bits (11), Expect = 2.0
 Identities = 11/11 (100%)
 Strand = Plus / Minus

                       
Query: 1877 tatagacctcc 1887
            |||||||||||
Sbjct: 368  tatagacctcc 358



 Score = 22.3 bits (11), Expect = 2.0
 Identities = 11/11 (100%)
 Strand = Plus / Plus

                       
Query: 1434 tgtgggcacca 1444
            |||||||||||
Sbjct: 1931 tgtgggcacca 1941


>13426|HD
          Length = 2075

 Score = 24.3 bits (12), Expect = 0.50
 Identities = 12/12 (100%)
 Strand = Plus / Plus

                        
Query: 1587 cctttaaatccc 1598
            ||||||||||||
Sbjct: 506  cctttaaatccc 517



 Score = 24.3 bits (12), Expect = 0.50
 Identities = 12/12 (100%)
 Strand = Plus / Minus

                        
Query: 1490 atggggctggag 1501
            ||||||||||||
Sbjct: 1168 atggggctggag 1157



 Score = 22.3 bits (11), Expect = 2.0
 Identities = 11/11 (100%)
 Strand = Plus / Plus

                       
Query: 1434 tgtgggcacca 1444
            |||||||||||
Sbjct: 625  tgtgggcacca 635



 Score = 22.3 bits (11), Expect = 2.0
 Identities = 11/11 (100%)
 Strand = Plus / Plus

                       
Query: 2346 ttcatttcctt 2356
            |||||||||||
Sbjct: 1299 ttcatttcctt 1309



 Score = 22.3 bits (11), Expect = 2.0
 Identities = 11/11 (100%)
 Strand = Plus / Plus

                       
Query: 1    tttttgttttt 11
            |||||||||||
Sbjct: 1322 tttttgttttt 1332



 Score = 22.3 bits (11), Expect = 2.0
 Identities = 11/11 (100%)
 Strand = Plus / Plus

                       
Query: 1    tttttgttttt 11
            |||||||||||
Sbjct: 1333 tttttgttttt 1343



 Score = 22.3 bits (11), Expect = 2.0
 Identities = 11/11 (100%)
 Strand = Plus / Minus

                       
Query: 557  gccacatatcc 567
            |||||||||||
Sbjct: 1986 gccacatatcc 1976


BLASTN 2.2.20 [Feb-08-2009]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaff
+er, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database sear
+ch
programs",  Nucleic Acids Res. 25:3389-3402.

Query= i:\13426 Chchd1 (22)\sequencing\13426_fasta.Contig2
         (2498 letters)

Database: c:\blast_temp\hu_hdBLASTdb 
           2 sequences; 4150 total letters

Searching..................................................done



                                                                 Score
+    E
Sequences producing significant alignments:                      (bits
+) Value

13426|HD                                                              
+938   0.0  
13426|HU                                                              
+ 94   7e-022

>13426|HD
          Length = 2075

 Score =  938 bits (473), Expect = 0.0
 Identities = 533/549 (97%), Gaps = 3/549 (0%)
 Strand = Plus / Minus

                                                                      
+  
Query: 436  atcgtatatatctggctcttaattgcagtggtatcaggctccctgggaataggtgcaa
+gg 495
            |||||||||||||| |||| ||||||| || ||||||||||||||| | ||| |||||
+| 
Sbjct: 1905 atcgtatatatctgtctct-aattgcactgctatcaggctccctggtactagttgcaa
+g- 1848

                                                                      
+  
Query: 496  aaggtgtaaggacagcaaggatggtcactgtggaacccaaggtcagtcctctacaaaa
+gg 555
            ||| ||| ||| |||| ||||||||||||||||||||||| |||||||||||||||||
+| 
Sbjct: 1847 aagctgtgagg-cagctaggatggtcactgtggaacccaatgtcagtcctctacaaaa
+gt 1789

                                                                      
+  
Query: 556  agcaagtacccttaaatggagtcagctctccagcccctaagtatattaactgtacaaa
+ta 615
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 1788 agcaagtacccttaaatggagtcagctctccagcccctaagtatattaactgtacaaa
+ta 1729

                                                                      
+  
Query: 616  aaataatatgtatctacagaatctctgggtatcagtatatgcacctgcttcagtaagc
+ac 675
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
+||
Sbjct: 1728 aaataatatgtatctacagaatctctgggtatcagtatatgcacttgcttcagtaagc
+ac 1669

                                                                      
+  
Query: 676  tttggacagactatttgtgaagtatgccctcactgaatacagctaatggcaaaaaggc
+tc 735
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
+||
Sbjct: 1668 tttggacagactatttgtgaagtatgccctcactgaatacagctgatggcaaaaaggc
+tc 1609

                                                                      
+  
Query: 736  tgcatacacagacttcattgctacttatgtatctaaaagccaaaggactaaatgatgt
+aa 795
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 1608 tgcatacacagacttcattgctacttatgtatctaaaagccaaaggactaaatgatgt
+aa 1549

                                                                      
+  
Query: 796  aggacttgaaaggcaacaaaagacattcagacttgctcatcaaaagcatatttggact
+gg 855
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 1548 aggacttgaaaggcaacaaaagacattcagacttgctcatcaaaagcatatttggact
+gg 1489

                                                                      
+  
Query: 856  gcagtggtggcgcatgcctttaatcccagcacttgggagaaagaggcaggcgatctcg
+ga 915
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 1488 gcagtggtggcgcatgcctttaatcccagcacttgggagaaagaggcaggcgatctcg
+ga 1429

                                                                      
+  
Query: 916  gtttgcgactggcctggtctacagagtgagttacaggacagccaggaatacacagaga
+aa 975
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 1428 gtttgcgactggcctggtctacagagtgagttacaggacagccaggaatacacagaga
+aa 1369

                     
Query: 976  ctctctttc 984
            |||||||||
Sbjct: 1368 ctctctttc 1360



 Score =  609 bits (307), Expect = e-177
 Identities = 307/307 (100%)
 Strand = Plus / Minus

                                                                      
+  
Query: 1036 ggaaatgaagagcatcccaggaataaagaacttccagggtttggggagattatagagc
+cc 1095
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 1307 ggaaatgaagagcatcccaggaataaagaacttccagggtttggggagattatagagc
+cc 1248

                                                                      
+  
Query: 1096 aagaaaggacgtgctcaggttggctcagaggttgggtgcttgcccagtgaagggaaag
+gc 1155
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 1247 aagaaaggacgtgctcaggttggctcagaggttgggtgcttgcccagtgaagggaaag
+gc 1188

                                                                      
+  
Query: 1156 agagatattcctcttcaggatggggctggaggtgtgaggagaagcagctaattagaag
+aa 1215
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 1187 agagatattcctcttcaggatggggctggaggtgtgaggagaagcagctaattagaag
+aa 1128

                                                                      
+  
Query: 1216 atggccaacttctttttagaggattttatttcaagacagcatccagaatacgattcat
+tc 1275
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 1127 atggccaacttctttttagaggattttatttcaagacagcatccagaatacgattcat
+tc 1068

                                                                      
+  
Query: 1276 aaaagagcaaaattaagtattttgcctcattttacccttcaaaaactcgtagcaatgc
+aa 1335
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+||
Sbjct: 1067 aaaagagcaaaattaagtattttgcctcattttacccttcaaaaactcgtagcaatgc
+aa 1008

                   
Query: 1336 atgcaaa 1342
            |||||||
Sbjct: 1007 atgcaaa 1001



 Score = 93.7 bits (47), Expect = 7e-022
 Identities = 102/119 (85%), Gaps = 1/119 (0%)
 Strand = Plus / Plus

                                                                      
+ 
Query: 859 gtggtggcgcatgcctttaatcccagcacttgggagaaagaggcagg-cgatctcggag
+t 917
           ||||||||||| ||||||||||||||||||||||||  |||||||||  ||| || |||
+|
Sbjct: 173 gtggtggcgcacgcctttaatcccagcacttgggaggcagaggcaggtggatttctgag
+t 232

                                                                      
Query: 918 ttgcgactggcctggtctacagagtgagttacaggacagccaggaatacacagagaaac
+ 976
           | | | |  |||||||||||| |||||||  |||||||||||||  |||||||||||||
Sbjct: 233 tcgaggccagcctggtctacaaagtgagtgccaggacagccagggctacacagagaaac
+ 291



 Score = 24.3 bits (12), Expect = 0.50
 Identities = 12/12 (100%)
 Strand = Plus / Minus

                        
Query: 391  aaacaaaacaaa 402
            ||||||||||||
Sbjct: 1324 aaacaaaacaaa 1313



 Score = 22.3 bits (11), Expect = 2.0
 Identities = 11/11 (100%)
 Strand = Plus / Plus

                       
Query: 2467 cctttcttggg 2477
            |||||||||||
Sbjct: 1240 cctttcttggg 1250


>13426|HU
          Length = 2075

 Score = 93.7 bits (47), Expect = 7e-022
 Identities = 102/119 (85%), Gaps = 1/119 (0%)
 Strand = Plus / Plus

                                                                      
+  
Query: 859  gtggtggcgcatgcctttaatcccagcacttgggagaaagaggcagg-cgatctcgga
+gt 917
            ||||||||||| ||||||||||||||||||||||||  |||||||||  ||| || ||
+||
Sbjct: 1479 gtggtggcgcacgcctttaatcccagcacttgggaggcagaggcaggtggatttctga
+gt 1538

                                                                      
+ 
Query: 918  ttgcgactggcctggtctacagagtgagttacaggacagccaggaatacacagagaaa
+c 976
            | | | |  |||||||||||| |||||||  |||||||||||||  ||||||||||||
+|
Sbjct: 1539 tcgaggccagcctggtctacaaagtgagtgccaggacagccagggctacacagagaaa
+c 1597



 Score = 38.2 bits (19), Expect = 3e-005
 Identities = 28/31 (90%)
 Strand = Plus / Minus

                                          
Query: 949 caggacagccaggaatacacagagaaactct 979
           |||||| ||||||  ||||||||||||||||
Sbjct: 569 caggactgccagggctacacagagaaactct 539



 Score = 22.3 bits (11), Expect = 2.0
 Identities = 11/11 (100%)
 Strand = Plus / Minus

                       
Query: 1223 acttcttttta 1233
            |||||||||||
Sbjct: 377  acttcttttta 367



 Score = 22.3 bits (11), Expect = 2.0
 Identities = 11/11 (100%)
 Strand = Plus / Minus

                       
Query: 1176 tggggctggag 1186
            |||||||||||
Sbjct: 748  tggggctggag 738


  Database: c:\blast_temp\hu_hdBLASTdb
    Posted date:  May 18, 2009  6:05 PM
  Number of letters in database: 4150
  Number of sequences in database:  2
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 2
Number of Hits to DB: 531
Number of extensions: 26
Number of successful extensions: 26
Number of sequences better than 10.0: 2
Number of HSP's gapped: 24
Number of HSP's successfully gapped: 24
Length of database: 4150
X1: 10 (19.8 bits)
X2: 15 (29.7 bits)
X3: 50 (99.1 bits)
S1: 10 (20.3 bits)
S2: 10 (20.3 bits)
[download]

I would appreciate your help in getting the correct output to my 2 out files.

Comment on Problem with getting the right object Download Code

Replies are listed 'Best First'.
Re: Problem with getting the right object by chromatic (Archbishop) on May 18, 2009 at 23:09 UTC
I'm not sure you've given us the right information to help you debug this, but a few lines of your code confuse me. When do you expect this condition to be false? `if(my $hsp = $hit->hsp('best')){` When do you expect this condition to be false? `if(my $hu_name = $hit->name){` ... and when do you expect it to differ from this condition? `elsif(my $hd_name = $hit->name)`	[reply] [d/l] [select]
Re^2: Problem with getting the right object by lomSpace (Scribe) on May 19, 2009 at 16:24 UTC
Hello Chromatic! I have revised it to make it simpler. I need to parse a blast report. I am using an if/else to print to 2 different out files. $hd_out should have: Name: 13426\|HD Percent Identity: 97.0856102003643 Alignment: Bio::SimpleAlign=HASH(0x4012f2c) and $hu_out should have: Name: 13426\|HU Percent Identity: 99.7737556561086 Alignment: Bio::SimpleAlign=HASH(0x401965c) Where "Bio::SimpleAlign=HASH(object)" is should have the actual data, which is an alignment. I am confused about dereferencing the hash object since it is a scalar($hu_aln, $hd_aln) in my code Read more... (3 kB) I am expecting to get two files. Each with the name, Percent ID, and the sequence alignment. Your help is appreciated! LomSpace	[reply] [d/l]
Re^3: Problem with getting the right object by chromatic (Archbishop) on May 19, 2009 at 19:03 UTC
`$hu_aln` and `$hd_aln` contain Bio::SimpleAlign objects. If you read the linked documentation, you may find that one of the methods of that class gives you access to the data you need. It doesn't support a default stringification, so you can't print the object directly and get what you expect. (I don't know what you expect, so I can't tell you which method is likely to help.)	[reply] [d/l] [select]
Re: Problem with getting the right object by ELISHEVA (Prior) on May 18, 2009 at 23:29 UTC
When your post contains a very long code sample (and this is several pages), it a good idea to surround the code section with `<readmore>` tags, like this: `<readmore> <code> ... my code here ... </code> </readmore>` [download] Using readmore tags can help people skimming the SOPW page focus on your question rather than being overwhelmed by the long code. Best, beth	[reply] [d/l] [select]
Re: Problem with getting the right object by toolic (Bishop) on May 18, 2009 at 23:43 UTC
A style note completely unrelated to your problem. You can interpolate your variables into quotes in a number of spots. For example, `print $hu_out "Name: ", $hu_name, "\n";` [download] can be simplified as: `print $hu_out "Name: $hu_name\n";` [download] Also, it is good practice to check the success of open.	[reply] [d/l] [select]
Re^2: Problem with getting the right object by lomSpace (Scribe) on May 19, 2009 at 12:25 UTC
Hi Toolic! Open works. I will reformat the post using 'read more' tags. Read more... (24 kB) Can you help me get the two files with the variables that I want? Also, I am getting a list of glob objects, which contain the two alignment strings. I want to return the alignment strings to the hu_aln and and hd_aln respectively. I appreciate your help.	[reply] [d/l]