I agree with the above, there are plenty of modules to help with parsing FASTA, the best documanted and supported are on BioPerl though:
http://www.bioperl.org/wiki/FASTA_sequence_format

Or you can set the line delimiter to the FASTA record separator (>) :
$/ = '>';
and slurp in the FASTA one record at a time.

As far as reverse complmenting goes, i am sure there is support out there, but it is very simple to do yourself:

my $seq = 'AGCTGATCGTAATAGAGCTA';
my $rev = rev_comp($seq,);
print "The reverse complement of \'$seq\' is \'$rev\'\n";
sub rev_comp{
  my $in = shift;
  ## reverse it
  my $rev_comp = reverse($in);
  ## complment it using tr///
  my $count = $rev_comp =~ tr/AGCT/TCGA/i; ## or tr/AGCTN/TCGAN/i if y
+ou have N's
  ## check we changed all the bases, or did something weird occur...
  if ($count = length($rev_comp){

    return $rev_comp;
  } else {

    ## not all bases were changed, 
    ## so something weird is happenning
    ## maybe you still have whitespace, or N's etc...

    return an error;
  }

}
[download]

Obviously this is a lengthy way of doing it but i am trying to keep things clear! Hope it helps.