in reply to Re: seeking help for seek function
in thread seeking help for seek function

i used readline function below seek, like this: 
$buffer = readline( *FH1 );
print("$buffer");

[download]
but it still doesnt give the right sequence.

Replies are listed 'Best First'.
Re^3: seeking help for seek function
by ikegami (Patriarch) on Mar 25, 2010 at 07:50 UTC
    You use tell for SID834.56 when the file pointer is here: 
    SID834.56    AGAAGTCGTACGATCA
[*]SID164.26    AGTCGATCATTATATATTCGCTAG

    [download]
    You want to use tell for SID834.56 when the file pointer is here: 
    SID834.56    [*]AGAAGTCGTACGATCA
SID164.26    AGTCGATCATTATATATTCGCTAG

    [download]
    That's not easy to do, but it's easy and acceptable to use tell for SID834.56 when the file pointer is here: 
    [*]SID834.56    AGAAGTCGTACGATCA
SID164.26    AGTCGATCATTATATATTCGCTAG

    [download]

    (i.e. before you read the line)

[reply]
[d/l]
[select]
      i just noticed that. i want to use file pointer at the begining of everyline.but, when i use tell function, why does it point to the end of the line and not the begining?
[reply]
      getting the correct position by using 
      my @indx;
my $pos = 0;

while(<FH1>){
    my ($id, $seq) = split /\t/;
    push(@indx, "$id\t$pos");
    $pos = tell FH1;
}

      [download]
      thanks for that !!! trying to read the correct line now...
[reply]
[d/l]
      i just noticed that. i want to use file pointer at the begining of everyline.but, when i use tell function, why does it point to the end of the line and not the begining?
[reply]

        After you've read a line, the file pointer will naturally always be at the end of the line (= beginning of the next line). That is so because for every byte being read, the file pointer advances by one.

        Try this to get the correct positions: 

        my @indx;
my $pos = 0;

while(<FH1>){
    my ($id, $seq) = split /\t/;
    push(@indx, "$id\t$pos");
    $pos = tell FH1;
}

        [download]
[reply]
[d/l]

In Section Seekers of Perl Wisdom