I want to write the complete header line (starting with '>') in my output files.  Can I use the split function ...?

Sure you can use the split function, but if you just want to print the header line as is (i.e. copy it from the input), you wouldn't need to split up the record. As you have it, the header would be printed already without further ado.  Think of it this way: $_ holds an entire record, with the leading '>' removed (to more easily handle the edge cases that result from the way the input is being split by $/).  For example, for the first record, $_ would hold the string (including the newlines)

"aw1.a1 bhi|tn|56564 pairs:40098
ATGCTAGATGCTAGCTAGCTAGCACTGAT
CGATGCTAGCGTAGTCAGCTGATGCTGTA
CGATGCTAGTCGTACG
"
[download]

You can do with it whatever you like before you print it out, e.g. take it apart using split or via regex captures, perform regex substitutions on it, etc.

Some more notes: The key for the hash is extracted via regex capture

my ($name) = /^(\w+)/;
[download]

which would extract "aw1" in this case, because \w+ stops matching at the dot. In case you'd need to extract keys as "aw1.a1" (or some such — I'm no fasta expert), you could modify the regex to also capture the dots

my ($name) = /^([\w.]+)/;
[download]

or up until the first whitespace char in the line

my ($name) = /^(\S+)/;
[download]

Or in case you'd want to print the headers only (which I'm not quite sure from your description), you could extract it similarly with a regex

my ($header) = /^([^\n]+)/;
[download]

or by splitting on newlines

my ($header) = split /\n/;
[download]

And so on...
Hope this gives you some starting points to tailor it to your specific requirements.

Thanks again almut!

I really appreciate your inputs.

I am trying to manipulate $_ to obtain the desired results. But when I split it with a newline the data-lines also split up. In this case, if a record holds more than one sequence data, the remaining records are not getting printed!

while (<FASTA>)
    {
    s/^>//mg;
#    print "$_";
    my ($name) = /^([^\n]+)/;
    
    #my ($name) = /^([\w.]+)/;
      
    #print "$name\n";
        if($hash{$name} == 10){
        select FILE1;
        }
        if($hash{$name} == 20){
        select FILE2;
        }
        if($hash{$name} == 30){
        select FILE3;
        }
    #print ">$_";
    my $output = $_;
    my (@title) = split(/\n/,$output);
    print ">".$title[0]."\n".$title[1]."\n";
}
[download]

I am splitting it with a new line character, in order to print the complete header line in my output files (and I am going wrong here).

Please suggest?

Thanks!

when I split it with a newline the data-lines also split up.

Instead of splitting on all newlines (as split would do by default)

    my (@title) = split(/\n/,$output);
[download]

you could tell split to split into two parts only:

    my ($title, $data) = split /\n/, $output, 2;
[download]

In this case, $data would hold all the remaining lines of sequence data.

That said, I'm not really sure why you want to split the record in the first place, if you then proceed to print out the parts with the same newline added in between them :)  I.e.

    ...
    print ">".$title."\n".$data."\n";
[download]

would result in the same output as

    print ">$output\n";
[download]