in reply to combine 2 fasta files into 1

It look like the F1 file has HTML in it and a <br> looks like a new line but it is not,
is just for formatting when you look at it with a browser like Internet Explorer.

Replies are listed 'Best First'.
Re^2: combine 2 fasta files into 1
by Generoso (Prior) on Jul 30, 2010 at 21:34 UTC

    Maybe this is what you are looking for.

    use warnings;
use strict; 

open( F1, "subsettest.txt" ) or die "file1: $!";
open( F2, "subsettest1.txt" ) or die "file2: $!";

while ( my $s1 = <F1> ) {
   my $s2 = <F2>;
   if ( $s1 =~ /^>/ ) {
      print $s1;
   } else {
      print $s2,$s1;  
   }
}
close F1;
close F2;
exit;

    [download]
    >GK9PVB108JH8SN rank=0000021 x=3781.0 y=885.0 length=137
40 38 38 30 30 30 38 40 40 30 30 30 36 40 40 40 40 40 40 40 40 40 40 4
+0 39 34 34 14 14 14 14 13 19 14 18 25 32 32 34 27 
TGATTATGAGTTAGATGTTCGCTCTGAGGTTTCAACGATGCTTCAAGATTCCTAATTCGCGTTGCGACTC
+TCGAGTATGCGTTCTATTCACATTTCTGTTGTCGTACATATTTGACTCACGATCTTGATTTCTTATC
>GK9PVB108JYDQ5 rank=0000032 x=3965.0 y=143.0 length=53
25 21 21 23 23 37 31 31 31 37 37 39 38 40 40 40 40 40 40 40 40 39 39 3
+9 39 35 23 25 25 37 34 35 36 37 37 37 37 37 39 39 40 40 40 40 39 38 3
+5 33 33 33 32 31 19 
GTTTTCAACGCTGGTTCGAGATTTCCTAATTTCACATTGCGACTCTCGAGTGC

    [download]
[reply]
[d/l]
[select]
      Thanks for your suggestion but removing the chomp function of my script doesn't solve my problem. It is still giving output that looks like this: 
      >GK9PVB108JRQBH rank=0000011 x=3889.0 y=1131.0 length=82
TCCATGTGTACAACTCATATGGAGCATCGATAGTATTAACAGTCTTGGTTGTGCGAGTTC

19 19 19 32 32 32 32 23 23 15 15 15 19 19 24 30 29 30 30 27 19 19 20 3
+0 35 35 33 31 31 31 31 32 32 30 23 16 15 15 15 24 28 28 25 22 17 17 1
+7 17 23 21 21 21 24 28 24 19 18 17 16 19
TTTGTTGTTTCCTTTAACTAAC

      [download]
      instead of: 
      >GK9PVB108JRQBH rank=0000011 x=3889.0 y=1131.0 length=82
TCCATGTGTACAACTCATATGGAGCATCGATAGTATTAACAGTCTTGGTTGTGCGAGTTCTTTGTTGTTT
+CCTTTAACTAAC
19 19 19 32 32 32 32 23 23 15 15 15 19 19 24 30 29 30 30 27 19 19 20 3
+0 35 35 33 31 31 31 31 32 32 30 23 16 15 15 15 24 28 28 25 22 17 17 1
+7 17 23 21 21 21 24 28 24 19 18 17 16 19

      [download]
[reply]
[d/l]
[select]

      Ok form what I figure you have several lines in F1 and you what to skip the first corresponding line in F2.

       
use warnings;
use strict; 

open( F1, "subsettest.txt" ) or die "file1: $!";
open( F2, "subsettest1.txt" ) or die "file2: $!";
my @s2s = ();
while ( my $s1 = <F1> ) {
   my $s2 = <F2>;
   if ( $s1 =~ /^>/ ) {
      foreach (@s2s) {print $_;}
      print $s1;
      @s2s = ();
   } else {
      push (@s2s,$s2);
      print $s1;  
   }
}
foreach (@s2s) {print $_;}
close F1;
close F2;
exit;

      [download]
[reply]
[d/l]

In Section Seekers of Perl Wisdom