file comparision and parsing

perl_new2011 has asked for the wisdom of the Perl Monks concerning the following question:

Hello experts, I am relatively new in perl (1 month) and have come up with the following problem. I sincerely hope I will get some direction from this forum. I have two text files. File 1 content look like

ABCDEFG0098GHT    J19.17
ABCDEFG0141314    J19.1
ABCDEFGQQ76890    WOK2234
ABCDEFG0Y56421    POK1
ABCDEFG00Z7657    FVT1
[download]

and so on Now file 2 looks like this:

>ABCDEFG0098GHT
ATTATGCGCGCGCTCGCTGCTCG
>ABCDEFG0098GHT
ATTATGCGCGCGCTCGCTGCTCG
>ABCDEFGQQ76890
TAGACAGATAGACAGATGACAGAT
[download]

Now I want to compare these two files. I specifically want to compare first column data of file 1 with that of the text present after the > sign in file 2 (data like ABCDEFG0098GHT). I only want to keep those data in file 2, that matches with POK or WOK in file 1. Can any body please help

20110113 Janitored by Corion: Added formatting, code tags, as per Writeup Formatting Tips

Comment on file comparision and parsing Select or Download Code

Replies are listed 'Best First'.
Re: file comparision and parsing by Utilitarian (Vicar) on Jan 11, 2011 at 12:03 UTC
Please add <code> tags around your data, you had to go through a preview page to post this and so you should have noticed it was badly formed. As to your problem: open file one while there are records in the file if the line contains a string followed by one of your required strings add the initial string to a hash of acceptable gene strings. open file 2 while there are records in the file if the line begins with a > and the rest of the line exists in your hash write this line to a temp file read the next line and add it to the temp file also (I think, not sure of what you have specified) rename the temp file to file2 if you wish to overwrite the original version. Code that up and come back with any specific issues you are having. `print "Good ",qw(night morning afternoon evening)[(localtime)[2]/6]," fellow monks."`	[reply] [d/l]
Re: file comparision and parsing by fisher (Priest) on Jan 11, 2011 at 09:56 UTC
Please use Markup in the Monastery. Your post isn't readable.	[reply]
Re: file comparision and parsing by umasuresh (Hermit) on Jan 11, 2011 at 19:08 UTC
As other monks have pointed out, use code tags. File comparisons and data extraction has been dealt with in multiple threads. Here is an example to help you get started Re: compare two files and update. Good Luck!	[reply]