Re^2: Bioinformatics: Slow Parsing of a Fasta File

Replies are listed 'Best First'.
Re^3: Bioinformatics: Slow Parsing of a Fasta File by BrowserUk (Patriarch) on Mar 23, 2011 at 06:21 UTC
I admit, I didn't think that that was legal. But anyway, the fix is quite trivial and has no affect upon performance: #! perl -slw use strict; use Data::Dump qw[ pp ]; my %sequences; local $/ = '>'; (undef) = scalar <DATA>; ## Discard first delimiter local $/ = "\n>"; while( my $record = <DATA> ) { my @lines = split "\n", $record; pop @lines if $lines[-1] eq '>'; my $id = shift @lines; $sequences{ $id } = join'', @lines; } pp \%sequences; __DATA__ >uc002yje.1 > chr21:13973492-13974491 cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga acgcgccctacactctggcatgggggaacccggccccgcagagccctgga CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG >uc002yje.2 > chr21:13974492-13975432 cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga acgcgccctacactctggcatgggggaaaaaacccggccccgcagagccctgga CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG >uc002yje.3 > chr21:13975431-13976330 cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga acgcgccctacactctggcatgggggaacccggccccgcagagggccctgga CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG [download] Produces: C:\test>fasta { "uc002yje.1 > chr21:13973492-13974491" => "cccctgccccaccgcaccctggatt +actgcacgccaagaccctcacctgaacgcgccctacactctggcatgggggaacccggccccgcagagc +cctggaCTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG", "uc002yje.2 > chr21:13974492-13975432" => "cccctgccccaccgcaccctggatt +actgcacgccaagaccctcacctgaacgcgccctacactctggcatgggggaaaaaacccggccccgca +gagccctggaCTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG", "uc002yje.3 > chr21:13975431-13976330" => "cccctgccccaccgcaccctggatt +actgcacgccaagaccctcacctgaacgcgccctacactctggcatgggggaacccggccccgcagagg +gccctggaCTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG", } [download] Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error. "Science is about questioning the status quo. Questioning authority". In the absence of evidence, opinion is indistinguishable from prejudice.	[reply] [d/l] [select]

Replies are listed 'Best First'.

Re^3: Bioinformatics: Slow Parsing of a Fasta File
by BrowserUk (Patriarch) on Mar 23, 2011 at 06:21 UTC

I admit, I didn't think that that was legal. But anyway, the fix is quite trivial and has no affect upon performance:

#! perl -slw
use strict;
use Data::Dump qw[ pp ];

my %sequences;

local $/ = '>';
(undef) = scalar <DATA>; ## Discard first delimiter

local $/ = "\n>";

while( my $record = <DATA> ) {
    my @lines = split "\n", $record;
    pop @lines if $lines[-1] eq '>';
    my $id = shift @lines;
    $sequences{ $id } = join'', @lines;
}
pp \%sequences;

__DATA__
>uc002yje.1 > chr21:13973492-13974491
cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga
acgcgccctacactctggcatgggggaacccggccccgcagagccctgga
CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG
>uc002yje.2 > chr21:13974492-13975432
cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga
acgcgccctacactctggcatgggggaaaaaacccggccccgcagagccctgga
CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG
>uc002yje.3 > chr21:13975431-13976330
cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga
acgcgccctacactctggcatgggggaacccggccccgcagagggccctgga
CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG
[download]

Produces:

C:\test>fasta
{
  "uc002yje.1 > chr21:13973492-13974491" => "cccctgccccaccgcaccctggatt
+actgcacgccaagaccctcacctgaacgcgccctacactctggcatgggggaacccggccccgcagagc
+cctggaCTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG",
  "uc002yje.2 > chr21:13974492-13975432" => "cccctgccccaccgcaccctggatt
+actgcacgccaagaccctcacctgaacgcgccctacactctggcatgggggaaaaaacccggccccgca
+gagccctggaCTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG",
  "uc002yje.3 > chr21:13975431-13976330" => "cccctgccccaccgcaccctggatt
+actgcacgccaagaccctcacctgaacgcgccctacactctggcatgggggaacccggccccgcagagg
+gccctggaCTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG",
}
[download]

Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.

"Science is about questioning the status quo. Questioning authority".

In the absence of evidence, opinion is indistinguishable from prejudice.

[reply]
[d/l]
[select]