bigmac3000lbs has asked for the wisdom of the Perl Monks concerning the following question:

Hi guys!

I'm working on a project where I am reading in values from a text file and then using them as search terms in a FASTA file. Ideally every time the program finds encounters the search term in the header section of the FASTA file, it should copy the header section of the FASTA file, along with the associated sequence into an output file. I've included examples of the kinds of data I am working with, along with the code I'm currently working on so you can get a better sense of what I am talking about.

Currently the problem I've been having with my code is that when I run it, it only outputs the results of the search conducted with the final term in the text file. It's that the program ran through the entire text file without performing any searches on the file to be searched, before stopping on the last item in the text file and performing a search. I should warn you that I just started programming in perl recently, so it is quite possible that my code has a few glaring errors that I've missed.

#Data from the text file I am using for search terms. Note these seque +nce ID names represent a subset of the sequences found in the FASTA f +ile I am searching through. The actual text file is much larger, cont +aining 1000s of terms. BF01013B2E03.f1 BF01010B1A11.f1 BF01028B1E03.f1 BF01029A2C12.f1 BF01028B2D11.f1 #Data from input FASTA file. I am searching through this file using th +e items from the text file shown above. The actual input FASTA file c +ontains 1000s more items > BF01013B2E03.f1 735 1 735 ABI CAATCCAAGAACATTTTGAAGAAAAAATCTCTTAAAAAAAAGAAATCAAAACAAGTGATCAAAAATGAAA +TGAATGGTCA > BF01010B1A11.f1 782 1 782 ABI AACGGACNANNCGGCAACCAGGAGGCCTTCCAAGCTGAACTGGGAGAGTGGATCAAGAAG > BF01028B2D11.f1 674 1 674 ABI CCAGCACNNNNTNAGATATTAGCCTAGCCTCTATGTCGTATTTGTATTTCNNCTAGTTTTTCATCCGACT +TTTTTGGATC #output file note the output file has only one sequence in it. This is + clearly not what I want. Something is wrong, I just can't put my fin +ger on it. > BF01028B2D11.f1 674 1 674 ABI CCAGCACNNNNTNAGATATTAGCCTAGCCTCTATGTCGTATTTGTATTTCNNCTAGTTTTTCATCCGACT +TTTTTGGATC #perl program #!/usr/bin/perl use strict; use File::Basename; my $database; my $data = shift(@ARGV); my $input_file = shift(@ARGV); my $infile; my $match; my $output_file; my $ESTs_W_SNPs; $output_file = "ESTsWsnpsANDgoodCoverage.fasta"; open ($database,'<', $data) or die "Cannot open $data\n"; while ($match = <$database>) { chomp $match; open (IN, $input_file) || die "Can't open input file. Please prov +ide a valid input filename.\n"; open ($ESTs_W_SNPs, '>', $output_file) or die "Cannot write to $o +utput_file\n"; my ($seq, $prevhead) = (0, "", ''); while(<IN>) { my $line = $_; $line =~ s/\r\n/\n/; chomp $line; $seq.= uc($line) if(eof(IN)); if (/\>(.*)/ || eof(IN)) { my $head=$1; printf $ESTs_W_SNPs ">$prevhead\n$seq\n" if($prevhead =~ /$ma +tch/); $prevhead = $head; $seq=''; } else { $seq.=$line; } } close (IN); close ($ESTs_W_SNPs); }

Replies are listed 'Best First'.
Re: Help troubleshoot FASTA parsing code.
by jwkrahn (Abbot) on Mar 23, 2011 at 20:45 UTC
    open ($ESTs_W_SNPs, '>', $output_file) or die "Cannot write to $o +utput_file\n";

    Every time you open this file it will overwrite the previous contents of the file so that at the end of the loop only the last line will be saved.    Either move this open outside the loop so it only executes once, or open the file in append mode so that the file doesn't get overwritten.

Re: Help troubleshoot FASTA parsing code.
by jellisii2 (Hermit) on Mar 23, 2011 at 20:47 UTC
    TO append your file, your file handle descriptor needs to have >>, not just >.