morio56 has asked for the wisdom of the Perl Monks concerning the following question:

Dear Monks, I am new to perl and still learning the ropes. I am trying to use the foreach loop but not getting the desired output. Here's my code: use warnings; 
print "Please enter the cns file:\n";
chomp($t=<STDIN>);
open(THE,$t) or die "Can not open file: $!\n";
@data=<THE>;
close THE;
$sequence='';
$end=0;
foreach $line(@data){
if($line=~/^\@/){
$chro=$line;
}elsif($line=~/^[a-zA-Z]/){
$sequence.=$line;
}else{
$end++
}
}
$sequence=~s/\s*$//g;

print $chro,"\n";
print $sequence,"\n";

[download]
The file am reading in looks like this: <@chr1 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn @chr2 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn> My problem is this will only output the last iteration i.e @chr2 followed by the nnnn's. How can I make it return the file the way it looks like from the input i.e. @chr1 nnnn.. followed by @chr2 nnn....? thanks.

Replies are listed 'Best First'.
Re: foreach loop
by wind (Priest) on May 04, 2011 at 16:23 UTC

    As documented in How do I post a question effectively?, please enclose your code in <code> tags so that people can read it:

    <code>
    ... your code here ...
    </code>

    Here's your code run through Perl::Tidy so that anyone else can help more easily:

    use warnings;

print "Please enter the cns file:\n";
chomp($t = <STDIN>);

open(THE, $t) or die "Can not open file: $!\n";
@data = <THE>;
close THE;

$sequence = '';
$end      = 0;

foreach $line (@data) {
    if ($line =~ /^\@/) {
        $chro = $line;
    } elsif ($line =~ /^[a-zA-Z]/) {
        $sequence .= $line;
    } else {
        $end++
    }
}

$sequence =~ s/\s*$//g;

print $chro,     "\n";
print $sequence, "\n";

    [download]
[reply]
[d/l]
      the brackets are there I don't know why they didn't show in the post.
[reply]

        Because you didn't put <code>...</code> tags around your code, and brackets have a special meaning here (for creating links). Please do that now, you can update your original post.

        Perl 6 - second systems done right
[reply]
[d/l]
Re: foreach loop
by ikegami (Patriarch) on May 04, 2011 at 16:56 UTC 
        if ($line =~ /^\@/) {
        print $chro,"\n" if length $chro;
        $chro = $line;
    }

    [download]
[reply]
[d/l]
      thanks for that. However, adding this line to my code only outputs: 
      @chr1
@chr2
nnnnn...

what I'd really like to have is:
@chr1
nnnnnnnnn...
@chr2
nnnnn....

      [download]
[reply]
[d/l]

        This uses ikegami's approach; this will print the previous $chro as soon as a new '@' is found. You seem to want to print $sequence at the same time. This moves the print statements inside the loop. Also, you need to reset sequence after the new @ is found. If you would give us something more detailed than 'nnnn' we could see where things should go. Try using __DATA__ next time to hold some sample data for everyone to see.

        use warnings;
use strict;

print "Using __DATA__ sample cns file:\n";
#chomp($t = <STDIN>);

#open(THE, $t) or die "Can not open file: $!\n";
#@data = <THE>;
my @data = <DATA>;
#close THE;

my $sequence="";
my $chro;

foreach my $line (@data) {
    if ($line =~ /^\@/) {
        print $chro if length $chro;
        $chro = $line;
        print $sequence;
        $sequence = "";
    } elsif ($line =~ /^[a-zA-Z]/) {
        $sequence .= $line;
    } else { print "no match: \$line=$line\n" }
}

#prints the last one, I'm sure theres a better way
print $chro if length $chro;
print $sequence,"\n";
    
__DATA__
@chr1
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
@chr2
CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC
@chr55
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG

        [download]

        Update: would be better to replace the foreach with while (my $line=<DATA>) and get rid of @data. Especially since the files will probably be large.

[reply]
[d/l]
[select]

Back to Seekers of Perl Wisdom