Re^14: Combining 3 files

Ok, now I'm more confused than ever and chasing my tail in frustration. This is where I am with the code. Any helpful suggestions are appreciated.

#!/usr/bin/perl
#22/06/2011

#use strict;
use warnings;
use File::Slurp;
use Data::Dumper;
my @data;
my @col;
my $dataset;
my @fields;
#my %out;
my $Hashref;
my $fileCount;
my @out; 
my @results;

open INFILE, "<Primer-Rev1" or die $!;
open my $outfh, '>', "outputfile.txt" or die $!;

    for my $nr (1..2) {
     for my $line (read_file('Primer-For'.$nr)) {
      my @col = split(/\t/,$line);


      push @{$data[$nr - 1]->{shift(@col)}},\@col;
     }
    }


while (<INFILE>){

        @col = split(/\t+/, $_);
        chomp (@col);
         my ($header, $length, $tm, $sequence) = @col[0..3];

        # expecting file3 line in @col

        my @results = ( $col[1], $col[2] );

#print Dumper (\@results)
}

for my $dataset (@data) {
    my @out = push @{
    $data[ $fileCount ]->{
        shift @col
    }
},  \@col;



#print Dumper (\@data);
}

    @out = 
        sort {
            my $diff_a = $col[2] - $a->[1];
            $diff_a *= -1 if $diff_a < 0;
            my $diff_b = $col[2] - $b->[1];
            $diff_b *= -1 if $diff_b < 0;
            $diff_a <=> $diff_b;
          }   @out;

print Dumper (\@out);

    push @results, $out[0]->[2];

#print Dumper (\@results);
#}
[download]

Comment on Re^14: Combining 3 files Download Code

Replies are listed 'Best First'.
Re^15: Combining 3 files by Anonymous Monk on Jun 28, 2011 at 17:16 UTC
Ok, now I'm more confused than ever and chasing my tail in frustration. You still have `my @out = push @{ $data[ $fileCount ]->{ ...` [download] Why?	[reply] [d/l]
Re^16: Combining 3 files by garyboyd (Acolyte) on Jun 29, 2011 at 08:45 UTC
Thanks anonymous monk!!! I now have a breakthrough!!! I think it helped me to sleep on things as well! So I removed the: `my @out = push @{ $data[ $fileCount ]->{ ...` [download] and now have : #!/usr/bin/perl #29/06/2011 #use strict; use warnings; use File::Slurp; use Data::Dumper; my @data, my @col, my @fields; my $dataset; #my %out; my $Hashref; my $fileCount; my @out; my @results; open INFILE, "<Primer-Rev1" or die $!; open my $outfh, '>', "outputfile.txt" or die $!; for my $nr (1..2) { for my $line (read_file('Primer-For'.$nr)) { my @col = split(/\t/,$line); push @{$data[$nr - 1]->{shift(@col)}},\@col; } } while (<INFILE>){ @col = split(/\t+/, $_); chomp (@col); my ($header, $length, $tm, $sequence) = @col[0..3]; # expecting file3 line in @col #} my @results = ( $col[0], $col[3] ); for my $dataset (@data) { my @beef = @{ $dataset->{ $col[0] } }; @beef = sort { my $diff_a = $col[2] - $a->[1]; $diff_a = -1 if $diff_a < 0; my $diff_b = $col[2] - $b->[1]; $diff_b = -1 if $diff_b < 0; $diff_a <=> $diff_b; } @beef; push @results, $beef[0]->[2]; #print Dumper (\@results); foreach (@results){ print $_."\n";} } } [download] I checked the output from @results and it is almost there generating the output. There are however strange things going on. output looks like: contig03841 CCAGGTTATTTATTTCAGCGGGAACT AGTAGTTCATAATAAAGAGGAGGCTGGT contig03841 CCAGGTTATTTATTTCAGCGGGAACT AGTAGTTCATAATAAAGAGGAGGCTGGT AGTAGTTCATAATAAAGAGGAGGCTGGA contig06486 GCAAATGGCTCTAAGGATCAGCC TTTTCCTGAGCGTTTTCCTGAGC contig06486 GCAAATGGCTCTAAGGATCAGCC TTTTCCTGAGCGTTTTCCTGAGC CATTTTTCCTGAGCGTTTTCCTGAGT contig09294 GTCGGAGCTCTCTCAGAACCC GCCCCAGAAGACATCACCTTCAT contig09294 GTCGGAGCTCTCTCAGAACCC GCCCCAGAAGACATCACCTTCAT contig100253 CACTCGAGTTGCAGTTATGTTCCTC AGATGATTTGTGCATTATAATTGTAATTTGGGC contig100253 CACTCGAGTTGCAGTTATGTTCCTC AGATGATTTGTGCATTATAATTGTAATTTGGGC GAGATGATTTGTGCATTATAATTGTAATTTGGGT [download] I think the gaps are where there are entries missing from the files. Is there a way to print out only those results in @results where there is data from all 3 input files? eg it will output `contig100253 CACTCGAGTTGCAGTTATGTTCCTC AGATGATTTGTGCATTATAATTGTAATTTGGGC GAGATGATTTGTGCATTATAATTGTAATTTGGGT` [download] rather than...... `contig100253 CACTCGAGTTGCAGTTATGTTCCTC AGATGATTTGTGCATTATAATTGTAATTTGGGC contig100253 CACTCGAGTTGCAGTTATGTTCCTC AGATGATTTGTGCATTATAATTGTAATTTGGGC GAGATGATTTGTGCATTATAATTGTAATTTGGGT` [download] I also want to output the data on one line tab-delimited, so for example `contig100253 AGATGATTTGTGCATTATAATTGTAATTTGGGC GAGATGATTTGTGCATTATAATTGTAATTTGGGT CACTCGAGTTGCAGTTATGTTCCTC`	[reply] [d/l] [select]
Re^17: Combining 3 files by Anonymous Monk on Jun 29, 2011 at 11:58 UTC
#use strict; .... I think the gaps are where there are entries missing from the files... And once again, we're back to Re^5: Combining 3 files I also want to output the data on one line tab-delimited So go ahead and print tabs instead of newlines, whats the problem? Maybe you should spend a few days with perlintro or http://learn.perl.org/books/beginning-perl/	[reply]
Re^18: Combining 3 files by garyboyd (Acolyte) on Jun 29, 2011 at 13:07 UTC