in reply to stupid/simple mistake

To count the number of occurrences of GATC in your string (this is a FAQ): 
perldoc -q count

[download]
use warnings;
use strict;

my $substring = 'GATC';
my $count     = 0;
my $sequence  = 'GAGAGACCCCGATCGAGAGACCCGATCFGAGAVCTGATCCCC';
while ($sequence =~ /$substring/g) { $count++ }
print "count = $count\n";

__END__

count = 3

[download]
See also: How do I compose an effective node title?

Replies are listed 'Best First'.
Re^2: stupid/simple mistake
by JavaFan (Canon) on Oct 18, 2011 at 13:05 UTC 
    while ($sequence =~ /$substring/g) { $count++ }

    [download]
    You never learned how to add numbers without using your fingers? ;-)

    I don't understand the urge to count one-by-one -- and you're not the first poster in this thread to do so. 

    while (<FILE>) {
    $count += () = /$substring/g;
}

    [download]
    ought to do it.
[reply]
[d/l]
[select]
      #!/usr/bin/perl
use warnings;
use strict;


open (FILE,"sequence.txt");


my $substring = 'GATC';
my$i=0;
my$count;
my $sequence;
my$result;
my $number=0;
my $string;
my $offset = 0;
my @results;
while ($sequence=<FILE>){
    
    foreach($sequence =~ /$substring/g) { 
   #print "malakas\n";
            $count += () = /$substring/g;
            $number++;
             my $result = index($sequence, $substring, $offset);
             
  while ($result != -1) {
        push (@results, $result);
    print "Found $substring at $result\n";

    $offset = $result + 1;
    $result = index($sequence, $substring, $offset);
    

  }
  
             
            #print "$count\n";
    }
    #print "$result\n";
     
}
foreach $result(@results){
my $sum
}
    print "There are $count GATCs";

      [download]

      ok now I have the positions into an array, but I need to calculate the distances between them, which is the sum of result(1)-result(0) + result(2)-result(1) +.... etc etc. I don't really know how to write that in code. any ideas? Thanks in advance again !

[reply]
[d/l]
        How about: 
        my @distances =();
for(my $c=1; $c< scalar @results; $c++){
   my $distances[($c-1)] = $results[$c] - $results[($c-1)];
}

        [download]


        Just typed the code in the coment, so you have to try it an tweak it as necessary. But it SHOULD work just fine ;)
[reply]
[d/l]
        while ($sequence=<FILE>){
    
    foreach($sequence =~ /$substring/g) { 
   #print "malakas\n";
            $count += () = /$substring/g;

        [download]
        Hmmm, copy-and-paste is too hard? I did not write a double loop. And your result just doesn't make much sense. In fact, it doesn't make any sense.

        Considering that spoon-feeding isn't working for you, I don't know what else to do.

[reply]
[d/l]

In Section Seekers of Perl Wisdom