Re^2: merging dna sequences

I too thought "bitwise string" but ended up with a different mix of operators:

my $s = 'AYGTACTAGACTACAGACTACAGACATCTACAGACTCATCAGCAGCATATTTA';
my $t = 'ACGTACTAGACTACAGACTACAGACATCTACAGACTCATCAGCAGCATATTKA';

tr/ACGTA-Z/\0\0\0\0_/ for my ($s_, $t_) = ($s, $t);

my $merged = ($s | $t_) & ($t | $s_);
say $merged;
[download]

Comment on Re^2: merging dna sequences Download Code

Replies are listed 'Best First'.
Re^3: merging dna sequences by Anonymous Monk on Nov 10, 2011 at 23:35 UTC
This one is inspired by moritz's solution, which only replaced the last "T" with a "K" in the first string. It has one less bit-op than my original, so should be a bit faster. (LOL... that one snuck up on me while typing) `my $s = 'AYGTACTAGACTACAGACTACAGACATCTACAGACTCATCAGCAGCATATTTA'; my $t = 'ACGTACTAGACTACAGACTACAGACATCTACAGACTCATCAGCAGCATATTKA'; (my $del = $t) =~ tr/ACGTA-Z/\0\0\0\0_/; (my $add = $t) =~ tr/ACGT/_/; my $merged = ($s \| $del) & $add; say $merged;` [download]	[reply] [d/l]

Replies are listed 'Best First'.

Re^3: merging dna sequences
by Anonymous Monk on Nov 10, 2011 at 23:35 UTC

my $s = 'AYGTACTAGACTACAGACTACAGACATCTACAGACTCATCAGCAGCATATTTA';
my $t = 'ACGTACTAGACTACAGACTACAGACATCTACAGACTCATCAGCAGCATATTKA';

(my $del = $t) =~ tr/ACGTA-Z/\0\0\0\0_/;
(my $add = $t) =~ tr/ACGT/_/;

my $merged = ($s | $del) & $add;
say $merged;
[download]

[reply]
[d/l]