MoniqueLT:

You're close. First, you don't need the .* at the beginning and end of the match. Next, you need to tell the regex to capture the sequence you're interested in. Finally, the captured text doesn't fall into $_, it falls into $1. Read perldoc perlre and look at the capture buffers section.

Here's a quickie example:

$ cat abc.pl 
#!/usr/bin/perl
use strict;
use warnings;

my $string = "AATCGGGTATGAAAAATTTTGCCGGCGTTTGCG";

if ($string =~ /ATGAA(.*?)TGCCG/) {
    my $sequence = $1;
    print "Found it: '$1'\n";
}
else {
    print "I don't see it!\n";
}

$ perl abc.pl
Found it: 'AAATTT'
[download]

Update: s/capture groups/capture buffers/

...roboticus

When your only tool is a hammer, all problems look like your thumb.