AAAAAAA
AAAAAAT
AAAAAAG
AAAAAAC
[download]

Are all your patterns the same length? Are they all upper case? Are you looking for exact (including case) matches only?

Is it possible to obtain a copy of the patterns file?

A small extract from a fasta file I have kicking around (HG:chr20):

...
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GATCCAgaggtggaagaggaaggaagcttggaaccctatagagttgctga
gtgccaggaccagatcctggccctaaacaggtggtaaggaaggagagagt
gaaggaactgccaggtgacacactcccaccatggacctctgggatcctag
ctttaagagatcccatcacccacatgaacgtttgaattgacagggggagc
...
[download]

index is usually faster for matching constant strings, but if you you want case independent matches, you would need to uc the sequences before searching (and studying).

Thanks. Yes, the patterns are of same length and the search is case sensitive.

How long does your current method take?

---

With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'

Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.

"Science is about questioning the status quo. Questioning authority".

In the absence of evidence, opinion is indistinguishable from prejudice.

The start of some sanity?

You may also want to check out index, since you the regex engine is more power than you really need.

Is there any other way instead of storing the matches in an array @matches to make the code faster? Thanks

I would expect swapping

        my @matches = ($seq{$key} =~ /$string/ig);
        #print "@matches\n";
        $result{$string} = scalar(@matches);
[download]

to

        $result{$string} =()= ($seq{$key} =~ /$string/ig);

would hit the spec of this request, but I would also expect the speed-up achieved would be negligible. The compound of two = operators with an empty list (()) puts the regex in list context, thus obtaining a count of all matches.

---

#11929 First ask yourself `How would I do this without a computer?' Then have the computer do it the same way.

One of the inputs is a file of 16384 strings given in below example format:

Given a string of 7 fasta characters, you can form 4^7= 16384 unique strings from T, A, G, C. So, his algorithm is checking every possible 7 char fasta string against the mutifasta file (number of lines in the multifasta file is 61913917).

In that case, it seems like a fairly simple regex should do it. I'd think one regex would be faster than using index to check 16384 different substrings, but a benchmark would tell for sure. I'm also not sure why he's reading the entire huge file into a hash; it seems like that could be running him into swap, slowing things down severely. Unless I'm missing something, it seems like this would work (as long as it's not necessary to match overlapping matches):

#!/usr/bin/env perl
use Modern::Perl;

my %c;

while(<DATA>){
    chomp;
    while(/([ACGT]{7})/g){
        $c{$1}++;
    }
}
say "$_ : $c{$_}" for sort keys %c;

__DATA__
NNNAGTACANNNNTAGCNNNNNNAGGTNNNNNAATCCGATNNNNNNTAGGGGGGTTTAAANNNNN
NNNAGTCCCACANNNNTAAAAGCNNNNNNAGGTNNNNNAATCCGATNNNNNNTAGGGGGGTTTAAANNNN
+N
NNNAGTACANNNNTAGCNNNNNNAGGTNNNNNAATCCGATNNNNNNTAGGGGGGTTTAAANNNNN
[download]

Aaron B.
Available for small or large Perl jobs; see my home node.

Unless I'm missing something, ... (as long as it's not necessary to match overlapping matches):

You hit the nail on the head. You'll only match 5,015,229 times when the OPs code matches 35,106,546 times.

However, with a modification to your regex, you can avoid that problem and find overlapping matches:

++$index{ $1 } while $$rSeq =~ m[(?=([ACGT]{7}))]g;
[download]

But it is still much slower than avoiding the regex engine completely:

[ 6:55:26.00] C:\test\humanGenome>..\976237 chr21.fa
16384
Using custom indexing found 35106546 matches; took 31.611258 seconds
Using custom index2 found 35106546 matches; took 27.504099 seconds
Using custom index3 found 35106546 matches; took 27.571143 seconds
Using quantified charclass lookahead found 35106546 matches; took 49.9
+54810 seconds
[download]

But ++ for thinking outside the box. (I can't believe I actually used that phrase :)

---

With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'

Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.

"Science is about questioning the status quo. Questioning authority".

In the absence of evidence, opinion is indistinguishable from prejudice.

The start of some sanity?