in reply to recursive algorithm

 GAGGGUCCUUUCAGUAGCAC ((...)..(((....)).))

Replies are listed 'Best First'.
Re^2: recursive algorithm
by remiah (Hermit) on Sep 06, 2012 at 07:43 UTC

    If your structure, "((...)..(((....)).))" means tree structure like s-expression in lisp, and "." matches any gene, "GAGGGUCCUUUCAGUAGCAC" could match 11 trees.

    Read more... (2 kB)

    I don't know what is "hydrogen bonds", no knowledge for genes. I hope you to describe what you are going to do, and get help of monks.

    sub parse() is a little modified one from kogai dan's example(written in japanese).

    regards

[reply]
[d/l]

In Section Seekers of Perl Wisdom