Dear Masters,
I have the following data and problem: 
my $k =25;
my %readrepo =(
 "readA" => "GCTGAGGCAGGAGAATTGCTTGAACCTGGGAGGCA",
 "readB" => "TACTCAGGAGGCTGAGGCAGGAGAATTGCTTGAAC",
 "readC" => "GCTGAGGCAGGAGAATTGCTTGAACTTAGGGGATG",
 "readD" => "TACTCGGGAGGCTGAGGCAGGAGAATTGCTTGAAC",
);


# This array is already ordered
# It says the first(_1) 25 bases of readA overlap with second(_2)part 
+of readB, etc.
my @readstoconcate = (
        "readA_1",
        "readB_2",
        "readC_1",
       "readD_2");

[download]
What I want to do is to assemble the reads in %readrepo based on the order given by @readstoconcatenate 
 readA                 GCTGAGGCAGGAGAATTGCTTGAACCTGGGAGGCA
 readB       TACTCAGGAGGCTGAGGCAGGAGAATTGCTTGAAC
 readC                 GCTGAGGCAGGAGAATTGCTTGAACTTAGGGGATG
 readD       TACTCGGGAGGCTGAGGCAGGAGAATTGCTTGAAC

[download]
Yielding the final long stretch of sequence 
TACTC(A,G)GGAGGAGAATTGCTTGAACCTGGGAGGCA(T,C)T(A,G)GG(A,G)G(A,G)(T,C)(A
+,G)

[download]
How should one go about it?
Update: Corrected the answer bug above. Thanks to BrowserUK suggestion.

---
neversaint and everlastingly indebted.......

In reply to Mustering Reads by neversaint

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.