Perhaps the following will be helpful:

use strict;
use warnings;
use autodie;

my ( %ids, $id );

open my $idFH, '<', 'sample_IDs.txt';
while (<$idFH>) {
    $ids{$1} = $2 if /(.+)\s+(.+)/;
}
close $idFH;

open my $sampleFH, '<', 'sample_reads.fasta';
while (<$sampleFH>) {
    s/\n/"_weight=$ids{$id}\n"/e
      if ($id) = /^(>\S+)/ and exists $ids{$id};
    print;
}
close $sampleFH;

[download]

This uses autodie to handle file-opening exceptions. Note, also, the use of lexical (my) file handles instead of barewords.

A regex captures the ID/val pairs from the IDs file, using those to build a hash. When the sample file is processed, the ID's captured. If that ID exists as a key in the hash, the \n is replaced by the desired string. All lines are printed.

Partial output on your datasets:

...

>comp10002_c0_seq3 len=99 path=[2446:0-34 1163:35-98]
TTTTTTGTGATATATTAAATAATATATAAAAATACTATGGCAGGAAGTTTAAATAAAGTC
TTATTAATAGGCCGTTTAGGCGCAGACCCAGATATAAAA
>comp10003_c0_seq1 len=166 path=[748:0-22 1004:23-46 2527:47-165]_weig
+ht=41
AAGTAGCCTATGCGCTACAGTAAGAAAGACAGGTGAAAAAATGGAAGTAAAACAATTAGA
TGACTACTTTGGATATACAGAAAAGGGCAGTTCCTTAGAGGGGGAATTACGAGCAGGACT
AACGACATTCTTGACAATGGCGTACATTCTGTTTGTGAACCCAGAC 
>comp10004_c0_seq1 len=143 path=[2167:0-44 2322:45-68 2508:69-142]_wei
+ght=25
AATCTTTAATTTAAACTTAAAAAAAATTAACTTTTGAAAGGAATTAAAATGGAAAAAGAA
ATGTTAGTAGTAGCTAAATTAAAAGAAGGTACATTTGAAAAATTTATGGGTTTCATGCAA
TCGCCTGAAGGTTTAGCAGAAAG 
>comp10005_c0_seq1 len=135 path=[2666:0-71 4268:72-134]_weight=96
AATATTACCAGAAGTTACAGGTGATGTGACTTATTTACATTGCTTCGGTGAGTGTTCAGG
TGATGGTACAGGTGAATGCCCAAGTGGCGCTGTAACATGGATGCTTACAATGACTGTAAA
TACTGCTAATATCAC 

...

[download]

In reply to Re: A program to extract the reads and modify the seq ID by Kenosis
in thread A program to extract the reads and modify the seq ID by Teju

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.