color output was difficult to save in text file

You can do it. It depends of the desired output format... want a yummy pdf?

my $dna = "AAAAAACAAACAAACCCAATATATATATACGACATATATTATATATTATACCCCGGG";
my $preciouss = substr $dna, 15, 28;
 
open (my $output, '>', "latex_file.tex");

print $output "\\documentclass{article}\n\\usepackage{color}\n";
print $output "\\begin{document}\n";
print $output "THIS IS MY BORING GENE: \\textcolor{red}{", $preciouss,
+ "}\\\\\\textcolor{blue}{OKAY, OKAY... \\textit{NOT SO BORING}, {\\bf
+ IS RED!}}";
print $output "\n\\end{document}";

close $output;

system("pdflatex latex_file.tex");
system("xpdf latex_file.pdf &");

[download]

You will need to have installed a decent tex distro and xpdf. See texlive. You can also translate to html, dvi or postscript easily from here, as you will

Update: typo fixed in textit and new link

In reply to Re: bold color text and export to file by pvaldes
in thread bold color text and export to file by newtoperlprog

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.