Hi. I am studying regular expressions and wanted to write a script that searches a DNA string for the longest substrings that consist of repeating letters. For example: CCCCC or GGG or AAAA etc. I managed to do that, but i am not very happy with the end resuslt. I was hoping to get most of the work done with a regex, in that regard i have failed. Furthermore there are statements in the while loop that look doubtful, and the idea of using an array to store the substring along with its length might not be good. Any advice is welcome. Thank you. 

use strict;
use warnings;

my $string = "AAATTTAGTTCTTAAGGCTGACATCGGTTTACGTCAGCGTTACCCCCCAAGTTATT
+GGGGACTTT";
my @substrings;

while($string =~ /([ACTG])(\1+)/g){
    my $comb = $1.$2;
    my $len = length($1) + length($2);    
    push @substrings, [$comb,$len];
}    

my @sorted = sort {$b->[1] <=> $a->[1]} @substrings;

foreach my $substring (@sorted){
    foreach my $element (@$substring){
        print "$element ";
    }
    print "\n";    
}

[download]

In reply to substrings that consist of repeating characters by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.