Hey everyone. So I have a nucleotide sequence to parse through in order to find all the matching pairs of dinucleotides (ex. AA, AT, CG, etc.). I'm having problems with the code for matching - I cannot figure out how to get matches for nucleotide pairs that overlap.

For example, here's a section from my nucleotide sequence and the code I utilize for matching 'AA':

$seq = AAGAATGCCAGTTTGTAAGTACTGACTTTGGAAAA

sub dtNTfreq {

    my ($seq = '';
    my $AA = 0;

   while ($myseq =~ /(AA)/gi ){
    $AA =$AA+1;
   }

[download]

Using that perl code for matching, I find 5 possible matches for 'AA'.

However, the actual number of matches is 6, since the last section of $seq has 'AAAA' which match as follows:

[AA] [AA]

or 

A [AA] A

[download]

I'm guessing I need to move through the sequence two nucleotides at a time to see if the match is true, but I'm unsure how to do so. Possibly by putting the while loop inside of a for loop that increments through the $seq string?

Any help is greatly appreciated.

In reply to Identifying Overlapping Matches in Nucleotide Sequence by FIJI42

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.