"... matching pairs..."

By chance I found this and slightly adopted it:

#!/usr/bin/env perl use strict; use warnings; use Data::Dump; use feature qw(say); my @s = split //, "AAAA"; my @m = map { $s[$_] . ' ' . $s[ $_ + 1 ] } 0 .. $#s - 1; dd \@m; say scalar @m; __END__

I'm still wondering why it works ;-)

Update: Getting the letters:

dd grep { $_ ne "" } split /[^A]/, q(AAGAATGCCAGTTTGTAAGTACTGACTTTGGAAAA);

Regards, Karl

«The Crux of the Biscuit is the Apostrophe»

perl -MCrypt::CBC -E 'say Crypt::CBC->new(-key=>'kgb',-cipher=>"Blowfish")->decrypt_hex($ENV{KARL});'Help


In reply to Re: Identifying Overlapping Matches in Nucleotide Sequence by karlgoethebier
in thread Identifying Overlapping Matches in Nucleotide Sequence by FIJI42

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.