Dear monks, I have many records in a file, and i want to iterate through the file, and do something with each record. e.g. my file looks like this: 
>gb|AE008687|:70-1377, Atu5000
ATGTCTGGACGTAAAGCGAGAATCATGTTGTATCTTTGGCGGGCTTTGGGCGGCAAACCGAACCTTGCCC
+GCCAAGGGGGCGATATGGCGATAGCGAAGCAGATTGAAGCAACGATCGGTCAAAAGGAAGATGCAGGTG
+G
>gb|AE008687|:1374-2405, Atu5001
ATGACCAGTAAGTCATCGCGTAAATCCATCGTTGCAAATTTCGGACTGCTGTCGGCGGAGCTTGAAAACC

[download]
For example, I want to calculate the number of A's in each record. I thought maybe the input record seperator may help, but i'm not sure how to use it. I have written a piece of code but am not sure how to treat each record individually. Sorry for such a low-level question. 
my $in_sequence = 0;
my @gene;
my $dna;

while (<INFILE>)   {

       my $line = $_;
       if ($line =~ /^>/)   {
            # print $line;
            $in_sequence = 1;
      }

      elsif ($in_sequence)  {
        $dna .= $line;
              }
}

print $dna;

[download]
AM

In reply to input record separator help by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.