Dear Masters,

Given a set of align sequences I want to compute the minimum number of substitution for each column. The example is below: 
CGGCGGAAAACTGTCCTCCGTGC   mouse
CGACGGAACATTCTCCTCCGCGC   rat 
CGACGGAATATTCCCCTCCGTGC   human 
CGACGGAAGACTCTCCTCCGTGC   chimp
 
00100000302011000000100   -> number of subst per site (max parsimony)

[download]
Is there a way to compute the value above? My current code does not do the job: 
use Data::Dumper;
use List::MoreUtils qw(uniq);

# The related phylogenetic in Newick format tree is:
my $tree = '(mouse,rat,(human,chimp))'; 

my $sites = [
    'CGGCGGAAAACTGTCCTCCGTGC', # mouse
    'CGACGGAACATTCTCCTCCGCGC', # rat
    'CGACGGAATATTCCCCTCCGTGC', # human
    'CGACGGAAGACTCTCCTCCGTGC', # chimp
];

my @val = my_parsimony($sites);
print Dumper \@val;

sub my_parsimony {

    my  $tfbs   = shift;
    my $mlen = length($tfbs->[0]);

    my $sum_min = 0;
    my @mincol;

    foreach my $pos ( 0 .. $mlen-1 ) {

        my @colbp = ();
        foreach my $site ( @{$tfbs} ) {
            my $bp = substr($site,$pos,1);
            push @colbp, $bp;

        }
        
       # this heuristic seems to be faulty
       # Column 11 it predicts 1 instead of 2 

        my $min_mm = scalar( uniq(@colbp) ) - 1;
        push @mincol, $min_mm;
    }

    return @mincol;
}

[download]
Actually I want to mimic Fitch's classical parsimony algorithm. But cannot fathom how to implement it.


Update:Problem resolved. Thanks everybody. psini+++.

---
neversaint and everlastingly indebted.......

In reply to Maximal Parsimony Problem by neversaint

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.