Dear Masters,
I have two files as input:

data1.txt 
>seq1
GGTACACAGAAGCCAAAGCAGGCTCCAGGCTCTGAGCTGTCAGCACAGAGACCGAT
>seq2
GTCTCTGTCTCTAAAATAAATAAACATTAAAAAAATTTTAAAAGAAAAGATTCTCTCC

[download]
data2.txt (this is called "hard masked") 
>seq1
GGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
>seq2
GTCTCTGTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTCTCTCC

[download]
My aim is to generate output by lower-casing data1.txt on the position of "N" that appears in data2.txt, yielding: 
>seq1
GGTacacagaagccaaagcaggctccaggctctgagctgtcagcacagagaccgaT
>seq2
GTCTCTGTCTCtaaaataaataaacattaaaaaaattttaaaagaaaaGATTCTCTCC

[download]
Typically, in real situation there are ~10^5 sequences, each of length 10^5 ~ 10^7 characters (upto 3.5Gb in file size).
I have a script that slurps two files together and then looping over sequence index. My approach is time consuming and memory inefficient. Thus, I look for enlightenment from my fellow monks on how to perform this task more efficiently.

Update: Running time comparison between BrowserUk's approach and mine is shown below.

---
neversaint and everlastingly indebted.......

In reply to Lower-casing Substrings and Iterating Two Files together by neversaint

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.