Hi all, I am a PhD student who is using perl to analyse some genome data. I am trying to write some code to extract a piece of sequence (given start and end co-ordinates ) from a fasta file of one genome. The fasta file format is:- >genome1 ACTGTTACTTGTACCTCAGGGTTTTCTCTTTTTTTACGCGCTCAGTCAGTCCCATG GTGCTGCCTGCATGCGTCAGTCA etc and then i have a text file which is tab-deliminated and has 3 columns, gene number, gene start and gene finish eg 1 0 825 2 837 1000 etc I would like the perl script to output the sequence for each gene to a different file with the gene number as the file name. Please help, even if its just to suggest where to start, i am feeling a bit lost at the moment. I presume i need to make an array of the gene positions, start and finish? but not sure where to go from there. Thanks Gemma

In reply to extract sequence given positions from fasta by Gemchal

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.