Boulder::Blast is probably one standard way of parsing BLASTN results (and other tag/val reports), and will do a good job of simplifying the data held in the record, from where you could split the match and reference sequences into individual characters, and compare them, outputting mismatched characters (and their positions within the match).

You might also want to check out bioperl: parse BLAST HSPs which gives some example code on handling the records, to get at the info you want.

Hope this helps - have a go, and if you get into further trouble re-post and I am sure many a Monk will rush to your aid - remember to include input/code/outpur/error messages etc...!

If the sequence strings being compared are always the same length, the string bitwise-xor trick is pretty quick and simple:

>perl -wMstrict -le
"my $seq1 = 'AATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACTACCATC';
 my $seq2 = 'AATGGGATCTAATTAAACTCAAGAGCTTCTGCACAGCAAAAGAAACTACCATC';
 my $diff = $seq1 ^ $seq2;
 $diff =~ tr{\x00-\xff}{.*};
 print $seq1;
 print $seq2;
 print $diff;
"
AATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACTACCATC
AATGGGATCTAATTAAACTCAAGAGCTTCTGCACAGCAAAAGAAACTACCATC
...................*.................................
[download]

If the string length are not the same (i.e., characters were inserted or deleted, not just altered in place), this trick will at least get you the position of the first difference, and you're on your own thereafter to re-synchronize and find any other diffs. (I'm sure there are already many tools on CPAN and elsewhere to do this sort of thing!)

I couldn't find any files of the correct format. I tried blastn at NCBI on NC_000009.11, but after waiting 45 minutes it said: "Informational Message: blastsrv4.REAL: Error: CPU usage limit was exceeded, resulting in SIGXCPU (24)." which probably just goes to show I don't know what the .... I'm doing.

So I based this upon your sample:

#! perl -slw
use strict;

my( $ID, $query, $off );
while( <DATA> ) {
    if( m[^>]  ) {
        ( $ID ) = (split '\|', $_)[ 1 ];
        next;
    }
    if( m[^Query] ) {
        ( $query ) = m[^Query\s+(\d+)];
        my $top = substr $_, 15;
        my $pipes = substr <DATA>, 15;
        my $bot = substr <DATA>, 15;
        my $p = 0;
        while( $p = 1+index $pipes, ' ', $p ) {
            printf "%20s :(%d) %1s/%1s\n",
             $ID, $query+$p,
             substr( $top, $p-1, 1 ),
             substr( $bot, $p-1, 1 );
        }
    }
}

__DATA__
[download]

Outputs:

c:\test\blast>..\853819.pl
           14079 ref :(75) A/C
           14080 ref :(15) A/A
           14080 ref :(90) T/T
           14080 ref :(124) G/G
           14080 ref :(129) C/C
           14080 ref :(136) A/A
           14081 ref :(75) A/C
[download]

HI Thanks for that! Insted of getting the position in reference to Query, I qould like to have them in reference to Subject. So, the output should be something like this. 14079 ref 487239 A/C. my tweaks other than your suggestions are here

#!/usr/local/bin/perl -sl
#

use strict;
use Getopt::Long;

my $home = $ENV{'HOME'};


my($ID, $query, $off, $idi, $subject);
print "ID\tposition\tvariation\n";
while(<DATA>) {
  next if $. <20;

  if(m[^>]) {
  
   ($ID) = (split '\|',$_)[1];
   
   #!/usr/local/bin/perl -sl
#

use strict;
use Getopt::Long;

my $home = $ENV{'HOME'};


my($ID, $query, $off, $idi, $subject);
print "ID\tposition\tvariation\n";
while(<DATA>) {
  next if $. <20;

  if(m[^>]) {
  
   ($ID) = (split '\|',$_)[1];
   
   
  }
 if(/^\s+Identities/){
   
   my($identity, undef) = split/,/ ;
   ($idi) = $identity =~ /\sIdentities\s\=\s\d{3}\/\d{3}\s\((\d{2,3}\%
+)\)$/;
 } 
  
 if($idi eq "95%") {
 
  if(m/^Query/) {
  ($query) = m[^Query\s+(\d+)];
   my $top = substr $_, 15;
   my $pipes = substr <DATA>,15;
   my $bot = substr <DATA>, 15;
   my $p = 0 ;
   while ($p = 1+index $pipes,' ', $p) {
     
    printf "%20s\t%d\t%1s/%1s\n",$ID,$query+$p, substr( $top, $p-1, 1 
+),substr( $bot, $p-1, 1 );
    
   }
 }
}
   
}
  }
 if(/^\s+Identities/){
   
   my($identity, undef) = split/,/ ;
   ($idi) = $identity =~ /\sIdentities\s\=\s\d{3}\/\d{3}\s\((\d{2,3}\%
+)\)$/;
 } 
  
 if($idi eq "95%") {
 
  if(m/^Query/) {
  ($query) = m[^Query\s+(\d+)];
   my $top = substr $_, 15;
   my $pipes = substr <DATA>,15;
   my $bot = substr <DATA>, 15;
   my $p = 0 ;
   while ($p = 1+index $pipes,' ', $p) {
     
    printf "%20s\t%d\t%1s/%1s\n",$ID,$query+$p, substr( $top, $p-1, 1 
+),substr( $bot, $p-1, 1 );
    
   }
 }
}
   
}
[download]

Thanks.

OH Yes, I managed find a way through it thanks for al wonderful suggestions.