in reply to Re^8: Comparing 2 different-sized strings
in thread Comparing 2 different-sized strings

Could you just tell me what the "for" is when you call the subroutine in the main program? I have seen "for" only in the context of a for loop where you also supply the 3 parameters like initial index, final, and increment.

Sure.

If there are multiple matches in the haystack, the subroutine will return a list of start positions, one for each match.

By giving that list to for, it will execute the print substr statement for each position returned; with $_ taking on each of those start positions one after the other.

Hence, this 

$hay = 'aacctgacctacgtttgacgatcgtacgtcagtcctccgtgctaactgacgtaaaaaaaata
+cgtcccccccc';
$nee = 'acgtacgt';

print substr( $hay, $_-5, length( $nee ) + 10 ) for fuzzyMatch( \$hay,
+ \$nee, 3 );

[download]

prints the 10 matches (+the 5 bytes before and after): 

acctgacctacgtttgac
gacctacgtttgacgatc
gtttgacgatcgtacgtc
gacgatcgtacgtcagtc
atcgtacgtcagtcctcc
gtcagtcctccgtgctaa
tgctaactgacgtaaaaa
aactgacgtaaaaaaaat
aaaaaaaatacgtccccc
aaaatacgtcccccccc

[download]
With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.

Replies are listed 'Best First'.
Re^10: Comparing 2 different-sized strings
by Anonymous Monk on Aug 18, 2013 at 13:20 UTC
    Hi, I hope you are doing well. Thank you for your help. I had another question. If I am searching for 2 sequences within the same haystack, and what separates the 2 sequences is always a "T" followed by one other nucleotide (either A,G,C,or T), how can I do that using the substr? I know how to do this with regular expressions easily, but here it seems I cannot incorporate: 
     substr( $hay, $_, length( $nee )) for fuzzyMatch( \$hay,
+ \$nee, 3 )

    [download]
    into a regular expression.
[reply]
[d/l]
      If I am searching for 2 sequences within the same haystack, and what separates the 2 sequences is always a "T" followed by one other nucleotide (either A,G,C,or T),

      Could you explain that a bit more?

      I get that you are looking for ???...????T[acgt]???..???; but that criteria will match everywhere a T occurs in a sequence, other than if it is the first, or second or third last, characters in the sequence. And without some constraints on the lengths of the pre & post T sequence length, there would be multiple (100s or 1000s or millions) possible matches at every T position.

      With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
      Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
      "Science is about questioning the status quo. Questioning authority".
      In the absence of evidence, opinion is indistinguishable from prejudice.
[reply]
[d/l]
        Hi, I'm not just looking for the T. For example, if I have the following sequence: 
        $hay = AACCCAGGATGCGCCATGCAGGACACAGGACGCCACGGAA
$nee1 = AGGA
$nee2 = CGCCAC

        [download]
        What I want is the following in regular expression: 
        $hay =~ /($nee1)T[ATGC]($nee2)/

        [download]
        So I only want $nee1 when it is directly followed by a T, some other nucleotide and $nee2. I don't want $nee1 and $nee2 anywhere else.
[reply]
[d/l]
[select]
      Hi, the last post was from me, Adrian. I'm sorry I forgot to log in.
[reply]

In Section Seekers of Perl Wisdom