Dear Monks
I have written a program to take a character in File 1 to be used to replace a character at that place in File2. Meanwhile
I am not getting the right output.
My Code is :-

#!/usr/bin/perl

use strict;
use warnings;

$location="";
my $qfn1 = "File1.txt";
my $qfn2 = "File2.txt";

my %positions;
{
   open(my $fh, '<', $qfn1)
      or die("Cannot open file \"$qfn1\": $!\n");

   while (<$fh>) {
      my ($key, $pos) = split /\s+/;
      $positions{$key} = $pos;
      $location = $3;
   }
}

my %sequences;
{
   open(my $fh, '<', $qfn2)
      or die("Cannot open file \"$qfn2\": $!\n");

   my $key;
   while (<$fh>) {
       if ( s/^>// ) {
           $key = ( split /\|/ )[1];
       }
       else {
           chomp;
           $sequences{$key} .= $_;
       }
   }


   if ( ! exists( $sequences{$key} )) {
       warn "KEY $key in File1 not found in File2\n";
       next;
                                      }
    my $dna = $sequences{$key};
    my $index = rindex($dna,$positions{$key});
    my $position = $index;
    my $current_base = substr($dna, $position, 1);
    my $newbase = $location;
     substr($dna,$position,1,$newbase);
      my  $Location = $position + 1;
        print "$sequences{$key}";
 }
[download]

My Input Files look like this:-

File 1:-
155369268 5 C 
169212695 7 T

File 2:-
>gi|155369268|ref|NM_001100917.1| After all
AAACAATGTCGATTCTATGATGCGAACGCAGCATTTCAGGGACTGGATGAGGAGCTTACGGTTTTTTACT
ACAGAATCATCAATATCTTGGAAGAAAAAGAATGTTAAGAAATAACAAAACAATAATTATTAAGTACTTT
>gi|169212695|ref|XM_001716884.1| Its the code 
AGACAAGCTTGTCCTGATGTTCCTTGCCCTGGCAGATGTTCAGGACCTTCCTTTGATTCAACCCCTCCAC
CTAAATGGCCCAAGCTTTCGGGGCTGTCATTGTCTGTTTGTCATTCAAGGGCCCAAGCTGAAGAGGGGGT
[download]

I am looking for an output in the same format as File2 but with a replaced character.
Like Suppose in case 155369268 my 5th position changes from A to C. My 169212695 7th position changes from G to T.
So the output would be like this:-

 
>gi|155369268|ref|NM_001100917.1| After all
AAACCATGTCGATTCTATGATGCGAACGCAGCATTTCAGGGACTGGATGAGGAGCTTACGGTTTTTTACT
ACAGAATCATCAATATCTTGGAAGAAAAAGAATGTTAAGAAATAACAAAACAATAATTATTAAGTACTTT
>gi|169212695|ref|XM_001716884.1| Its the code 
AGACAATCTTGTCCTGATGTTCCTTGCCCTGGCAGATGTTCAGGACCTTCCTTTGATTCAACCCCTCCAC
CTAAATGGCCCAAGCTTTCGGGGCTGTCATTGTCTGTTTGTCATTCAAGGGCCCAAGCTGAAGAGGGGGT
[download]

good bye

20081224 Janitored by Corion: Restored content

---

---

Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!

Titles consisting of a single word are discouraged, and in most cases are disallowed outright.

Read Where should I post X? if you're not absolutely sure you're posting in the right place.

Please read these before you post! —

• How do I compose an effective node title?
• How do I post a question effectively?
• Markup in the Monastery

Posts may use any of the Perl Monks Approved HTML tags:

a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr

You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)

	For:		Use:
	&		&
	<		&lt;
	>		&gt;
	[		&#91;
	]		&#93;

Link using PerlMonks shortcuts! What shortcuts can I use for linking?

See Writeup Formatting Tips and other pages linked from there for more info.