If the sequence strings being compared are always the same length, the string bitwise-xor trick is pretty quick and simple: 

>perl -wMstrict -le
"my $seq1 = 'AATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACTACCATC';
 my $seq2 = 'AATGGGATCTAATTAAACTCAAGAGCTTCTGCACAGCAAAAGAAACTACCATC';
 my $diff = $seq1 ^ $seq2;
 $diff =~ tr{\x00-\xff}{.*};
 print $seq1;
 print $seq2;
 print $diff;
"
AATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACTACCATC
AATGGGATCTAATTAAACTCAAGAGCTTCTGCACAGCAAAAGAAACTACCATC
...................*.................................

[download]

If the string length are not the same (i.e., characters were inserted or deleted, not just altered in place), this trick will at least get you the position of the first difference, and you're on your own thereafter to re-synchronize and find any other diffs. (I'm sure there are already many tools on CPAN and elsewhere to do this sort of thing!)

In reply to Re: parsing mismatch from blast output by AnomalousMonk
in thread parsing mismatch from blast output by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.