in reply to Re^6: Comparing 2 different-sized strings
in thread Comparing 2 different-sized strings

why not just from 0 to length(nee)?

Because if you compare at position lenght( hay), you aren't comparing anything.

Take the case of a 20-byte haystack:acgtacgtacgtacgtacgt and a 4-byte needle: acct; at position 20:

000000001111111111112 012345678901234567890 acgtacgtacgtacgtacgt acct

The last position you can get a full match is at 20-4 position 16:

000000001111111111112 012345678901234567890 acgtacgtacgtacgtacgt acct

With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.

Replies are listed 'Best First'.
Re^8: Comparing 2 different-sized strings
by AdrianJ217 (Novice) on Aug 12, 2013 at 14:08 UTC
    Hi, Thank you so much for your help. Could you just tell me what the "for" is when you call the subroutine in the main program? I have seen "for" only in the context of a for loop where you also supply the 3 parameters like initial index, final, and increment. By the way, everything else you explained to me I completely understood and my script now works perfectly. Thank you so much!!
      Could you just tell me what the "for" is when you call the subroutine in the main program? I have seen "for" only in the context of a for loop where you also supply the 3 parameters like initial index, final, and increment.

      Sure.

      If there are multiple matches in the haystack, the subroutine will return a list of start positions, one for each match.

      By giving that list to for, it will execute the print substr statement for each position returned; with $_ taking on each of those start positions one after the other.

      Hence, this

      $hay = 'aacctgacctacgtttgacgatcgtacgtcagtcctccgtgctaactgacgtaaaaaaaata +cgtcccccccc'; $nee = 'acgtacgt'; print substr( $hay, $_-5, length( $nee ) + 10 ) for fuzzyMatch( \$hay, + \$nee, 3 );

      prints the 10 matches (+the 5 bytes before and after):

      acctgacctacgtttgac gacctacgtttgacgatc gtttgacgatcgtacgtc gacgatcgtacgtcagtc atcgtacgtcagtcctcc gtcagtcctccgtgctaa tgctaactgacgtaaaaa aactgacgtaaaaaaaat aaaaaaaatacgtccccc aaaatacgtcccccccc

      With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
      Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
      "Science is about questioning the status quo. Questioning authority".
      In the absence of evidence, opinion is indistinguishable from prejudice.
        Hi, I hope you are doing well. Thank you for your help. I had another question. If I am searching for 2 sequences within the same haystack, and what separates the 2 sequences is always a "T" followed by one other nucleotide (either A,G,C,or T), how can I do that using the substr? I know how to do this with regular expressions easily, but here it seems I cannot incorporate:
        substr( $hay, $_, length( $nee )) for fuzzyMatch( \$hay, + \$nee, 3 )
        into a regular expression.
      Ok, thank you. Now I understand a lot more about using bitwise approaches to Perl. I also just noticed your post from a while ago regarding Hamming Distance: my $s1 = 'AAAAA'; my $s2 = 'ATCAA'; my $s3 = 'AAAAA'; print "$s1:$s2 hd:", hd( $s1, $s2 ); # will give value 2 print "$s1:$s3 hd:", hd( $s1, $s3 ); # will give value 0 sub hd{ length( $_ 0 ) - ( ( $_ 0 ^ $_ 1 ) =~ tr\0\0 ) } I just didnt understand the line above defining the subroutine. How do you know which part refers to which sequence ($s1 vs $s2 for example)? Thank you so much! I can't believe how helpful and patient you are.
        How do you know which part refers to which sequence ($s1 vs $s2 for example)?

        Sorry, but you are going to have to clarify that question. Which "part" of what?

        (You should also have used <code></code> tags;

        and it is helpful when you reference another post to link to it Re: Hamming Distance Between 2 Strings - Fast(est) Way? using [id://500244])


        With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
        Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
        "Science is about questioning the status quo. Questioning authority".
        In the absence of evidence, opinion is indistinguishable from prejudice.