in reply to Re^2: translating multiple DNA sequence to protein sequence
in thread translating multiple DNA sequence to protein sequence

This won't work when numerous DNA sequences in fasta file

  • Comment on Re^3: translating multiple DNA sequence to protein sequence

Replies are listed 'Best First'.
Re^4: translating multiple DNA sequence to protein sequence
by choroba (Cardinal) on Aug 22, 2013 at 09:25 UTC
    I tested the code with the following data:
    >header1
ATGATCTAGTCGATCGCTAGCTAGATCGCTAGCTG
CATGATCTAGTCGATCGCTAGCTAGATCGCTAGCTGC
>header2
ATGATCTAGTCGATCGCTAGCTAGATCGCTAGCTGC
ATGATCTAGTCGATCGCTAGCTAGATCGCTAGCTGC

    [download]
    It gives the follwoing output:
    Read more... (1211 Bytes)
    Please, be more specific and explain what you mean by "won't work".
    لսႽ† ᥲᥒ⚪⟊Ⴙᘓᖇ Ꮅᘓᖇ⎱ Ⴙᥲ𝇋ƙᘓᖇ
[reply]
[d/l]
[select]

      from the output I concluded that it is only for the ">header1". Moreover, this is not the required output

      the output which i require is something like that:

      >header1
HGADFFADJHGAJFGAFLGJ
>header2
HJFSAGJFADGADKJAHGHJ

      [download]

      The UPPERCASE is the translated sequence of the DNA sequences

[reply]
[d/l]
        I see both header1 and header2 in the output. Moving one part of the print out of the loop is rather easy, you should study how loops work.
        لսႽ† ᥲᥒ⚪⟊Ⴙᘓᖇ Ꮅᘓᖇ⎱ Ⴙᥲ𝇋ƙᘓᖇ
[reply]

In Section Seekers of Perl Wisdom