in reply to Re^3: translating multiple DNA sequence to protein sequence
in thread translating multiple DNA sequence to protein sequence

I tested the code with the following data:
>header1
ATGATCTAGTCGATCGCTAGCTAGATCGCTAGCTG
CATGATCTAGTCGATCGCTAGCTAGATCGCTAGCTGC
>header2
ATGATCTAGTCGATCGCTAGCTAGATCGCTAGCTGC
ATGATCTAGTCGATCGCTAGCTAGATCGCTAGCTGC

[download]
It gives the follwoing output:
>header1        M
>header1        I
>header1        _
>header1        S
>header1        I
>header1        A
>header1        S
>header1        _
>header1        I
>header1        A
>header1        S
>header1        C
>header1        M
>header1        I
>header1        _
>header1        S
>header1        I
>header1        A
>header1        S
>header1        _
>header1        I
>header1        A
>header1        S
>header1        C
>header2        M
>header2        I
>header2        _
>header2        S
>header2        I
>header2        A
>header2        S
>header2        _
>header2        I
>header2        A
>header2        S
>header2        C
>header2        M
>header2        I
>header2        _
>header2        S
>header2        I
>header2        A
>header2        S
>header2        _
>header2        I
>header2        A
>header2        S
>header2        C

[download]
Please, be more specific and explain what you mean by "won't work".
لսႽ† ᥲᥒ⚪⟊Ⴙᘓᖇ Ꮅᘓᖇ⎱ Ⴙᥲ𝇋ƙᘓᖇ

Replies are listed 'Best First'.
Re^5: translating multiple DNA sequence to protein sequence
by yuvraj_ghaly (Sexton) on Aug 22, 2013 at 10:22 UTC

    from the output I concluded that it is only for the ">header1". Moreover, this is not the required output

    the output which i require is something like that:

    >header1
HGADFFADJHGAJFGAFLGJ
>header2
HJFSAGJFADGADKJAHGHJ

    [download]

    The UPPERCASE is the translated sequence of the DNA sequences

[reply]
[d/l]
      I see both header1 and header2 in the output. Moving one part of the print out of the loop is rather easy, you should study how loops work.
      لսႽ† ᥲᥒ⚪⟊Ⴙᘓᖇ Ꮅᘓᖇ⎱ Ⴙᥲ𝇋ƙᘓᖇ
[reply]

        okay thank you....I will post the code as soon as i get it right...cheers

[reply]

In Section Seekers of Perl Wisdom