in reply to Re: Sequence alignment
in thread Sequence alignment

why this code doesn't work with me !!!

Replies are listed 'Best First'.
Re^3: Sequence alignment
by marto (Cardinal) on Oct 28, 2013 at 12:22 UTC
Re^3: Sequence alignment
by Athanasius (Cardinal) on Oct 28, 2013 at 12:34 UTC

    Although marto is quite right, perhaps I can make an educated guess here?

    The code as given by snape is incomplete. When I add this before the code:

    #! perl use strict; use warnings; my $MATCH = 1; my $MISMATCH = -1; my $GAP = -1; chomp(my $seq1 = <DATA>); chomp(my $seq2 = <DATA>);

    and this after the code:

    __DATA__ ATGTAGACCTAGATCATGATGACTGATGAT ATTACCGATGACTGATGACTGATGACTGAT

    I get the same output as reported by snape.

    Disclaimer: I have no knowledge of the Needleman Wunsch algorithm (if that’s what this code is implementing), nor of what it’s for. :-)

    Hope that helps,

    Athanasius <°(((><contra mundum Iustus alius egestas vitae, eros Piratica,