in reply to Re^2: Sequence alignment
in thread Sequence alignment
Although marto is quite right, perhaps I can make an educated guess here?
The code as given by snape is incomplete. When I add this before the code:
#! perl use strict; use warnings; my $MATCH = 1; my $MISMATCH = -1; my $GAP = -1; chomp(my $seq1 = <DATA>); chomp(my $seq2 = <DATA>);
and this after the code:
__DATA__ ATGTAGACCTAGATCATGATGACTGATGAT ATTACCGATGACTGATGACTGATGACTGAT
I get the same output as reported by snape.
Disclaimer: I have no knowledge of the Needleman Wunsch algorithm (if that’s what this code is implementing), nor of what it’s for. :-)
Hope that helps,
| Athanasius <°(((>< contra mundum | Iustus alius egestas vitae, eros Piratica, |
|
|---|