Re: Create the reverse complement DNA sequence without pattern matching and reverse built-in function?

Sure there is. You could even reimplement an entire regular expression engine using substr, though I wouldn't recommend it. However, you're not using a regular expression here, you're using transliteration: tr///.


my $seq="ACGGGAGGACGGGAAAATTACTACGGCATTAGC";

my %xref = ( 
  A => 'T', C => 'G', G => 'C', T => 'A',
  a => 't', c => 'g', g => 'c', t => 'a',
);

for(my $ix = 0; $ix < length $seq; ++$ix ) {
    substr( $seq, $ix, 1, $xref{ substr( $seq, $ix, 1 ) } );
}

my $reverse = reverse($seq);
print $reverse, "\n";
[download]

Proof you can write "almost C" in Perl.

I would expect this to be tremendously slower than using tr/// on large data sets.

Dave

Comment on Re: Create the reverse complement DNA sequence without pattern matching and reverse built-in function? Select or Download Code

Replies are listed 'Best First'.
Re^2: Create the reverse complement DNA sequence without pattern matching and reverse built-in function? by atcroft (Abbot) on Feb 19, 2014 at 15:13 UTC
Another similar approach, for illustration purposes: `perl -Mstrict -Mwarnings -le 'my $seq=q{ACGGGAGGACGGGAAAATTACTACGGCATTAGC}; my $complement; my %rc = ( A => q{T}, T => q{A}, C => q{G}, G => q{C}, ); my @letters = split //, $seq; while ( @letters ) { my $l = uc pop @letters; $complement .= $rc{$l}; } print $seq; print $complement;'` [download] Hope that helps.	[reply] [d/l]

Replies are listed 'Best First'.

Re^2: Create the reverse complement DNA sequence without pattern matching and reverse built-in function?
by atcroft (Abbot) on Feb 19, 2014 at 15:13 UTC

Another similar approach, for illustration purposes:

perl -Mstrict -Mwarnings -le 'my 
$seq=q{ACGGGAGGACGGGAAAATTACTACGGCATTAGC}; my $complement; 
my %rc = ( A => q{T}, T => q{A}, C => q{G}, G => q{C}, ); 
my @letters = split //, $seq; while ( @letters ) { 
my $l = uc pop @letters; $complement .= $rc{$l}; } 
print $seq; print $complement;'
[download]

Hope that helps.

[reply]
[d/l]